Orthologous regulated operons containing znuA2 gene
| Regulog: | Zur - Mycobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Mycobacterium sp. JLS | ||||
|
Position: -90
Score: 6.21096 Sequence: TGTTGAAAATGATTTTCATTA
Locus tag: Mjls_5110
Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: Mjls_5109
Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: Mjls_5108
Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Mjls_5107
Name: Mflv_3560 Funciton: putative secreted protein |
||||
| znuB2-znuB2-znuA2-Mflv_3560 | -90 | 6.2 | TGTTGAAAATGATTTTCATTA | Mjls_5110 |
| Mycobacterium vanbaalenii PYR-1 | ||||
|
Position: -39
Score: 6.37103 Sequence: TATTGAAAATGATTGTCATTA
Locus tag: Mvan_5325
Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: Mvan_5324
Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Mvan_5323
Name: Mflv_3560 Funciton: putative secreted protein |
||||
| znuB2-znuA2-Mflv_3560 | -39 | 6.4 | TATTGAAAATGATTGTCATTA | Mvan_5325 |