Orthologous regulated operons containing yciC3 gene
| Regulog: | Zur - Mycobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Mycobacterium avium 104 | ||||
|
Position: -136
Score: 5.80851 Sequence: TATTGAAAATCATTTTCGACA
Position: -81
Score: 5.54983 Sequence: AGATGAAAACGATTACCAATA
Locus tag: MAV_4874
Name: yciC3 Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
||||
| yciC3 | -136 | 5.8 | TATTGAAAATCATTTTCGACA | MAV_4874 |
| -81 | 5.5 | AGATGAAAACGATTACCAATA | ||
| Mycobacterium flavescens PYR-GCK | ||||
|
Position: -87
Score: 5.80851 Sequence: TATTGAAAATCATTTTCGACA
Position: -32
Score: 5.30713 Sequence: TATTGAAGATCATTCCCATTA
Locus tag: Mflv_1313
Name: yciC3 Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
||||
| yciC3 | -87 | 5.8 | TATTGAAAATCATTTTCGACA | Mflv_1313 |
| -32 | 5.3 | TATTGAAGATCATTCCCATTA | ||
| Mycobacterium vanbaalenii PYR-1 | ||||
|
Position: -90
Score: 5.54213 Sequence: TATTGGAAATCGTTTTCGACA
Position: -35
Score: 5.79585 Sequence: TATTGGAAATCATTCCCATTA
Locus tag: Mvan_5488
Name: yciC3 Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
||||
| yciC3 | -90 | 5.5 | TATTGGAAATCGTTTTCGACA | Mvan_5488 |
| -35 | 5.8 | TATTGGAAATCATTCCCATTA | ||