Orthologous regulated operons containing znuA gene
| Regulog: | Zur - Mycobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Mycobacterium abscessus ATCC 19977 | ||||
|
Position: -43
Score: 6.45345 Sequence: TAATGAAAATCGTTTTCATTA
Locus tag: MAB_0577c
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: MAB_0576c
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: MAB_0575c
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: MAB_0574c
Name: lamB Funciton: Conserved hypothetical protein (LamB/YcsF) |
||||
| znuA-znuC-znuB-lamB | -43 | 6.5 | TAATGAAAATCGTTTTCATTA | MAB_0577c |
| Mycobacterium avium 104 | ||||
|
Position: -63
Score: 6.25081 Sequence: TAATGGAAACGATTTTCATTA
Locus tag: MAV_0583
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: MAV_0582
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: MAV_0581
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: MAV_0580
Name: lamB Funciton: Conserved hypothetical protein (LamB/YcsF) |
||||
| znuA-znuC-znuB-lamB | -63 | 6.3 | TAATGGAAACGATTTTCATTA | MAV_0583 |
| Mycobacterium flavescens PYR-GCK | ||||
|
Position: -2
Score: 5.28781 Sequence: TAATGAAAACGGTTATCGTAT
Locus tag: Mflv_1454
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Mflv_1455
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Mflv_1456
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| znuA-znuC-znuB | -2 | 5.3 | TAATGAAAACGGTTATCGTAT | Mflv_1454 |
| Mycobacterium marinum M | ||||
|
Position: -32
Score: 6.05626 Sequence: TAATGGAAACGGTTGTCATTA
Locus tag: MMAR_5071
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: MMAR_5072
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: MMAR_5073
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| znuA-znuC-znuB | -32 | 6.1 | TAATGGAAACGGTTGTCATTA | MMAR_5071 |
| Mycobacterium smegmatis str. MC2 155 | ||||
|
Position: -90
Score: 6.09939 Sequence: TATCGAAAATGATTTTCAATA
Position: -44
Score: 5.34837 Sequence: TAATGCAAACGGTTATCGTTA
Locus tag: MSMEG_6047
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: MSMEG_6046
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: MSMEG_6045
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| znuA-znuC-znuB | -90 | 6.1 | TATCGAAAATGATTTTCAATA | MSMEG_6047 |
| -44 | 5.3 | TAATGCAAACGGTTATCGTTA | ||
| Mycobacterium sp. JLS | ||||
|
Position: -88
Score: 5.53056 Sequence: AAATGCAAACCGTTATCATTA
Locus tag: Mjls_5104
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Mjls_5103
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Mjls_5102
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| znuA-znuC-znuB | -88 | 5.5 | AAATGCAAACCGTTATCATTA | Mjls_5104 |
| Mycobacterium tuberculosis H37Rv | ||||
|
Position: -85
Score: 5.80851 Sequence: TATTGAAAATCATTTTCGACA
Position: -30
Score: 5.55538 Sequence: TAATGAAAACTGTTATCGATA
Locus tag: Rv2059
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Rv2060
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| znuA-znuB | -85 | 5.8 | TATTGAAAATCATTTTCGACA | Rv2059 |
| -30 | 5.6 | TAATGAAAACTGTTATCGATA | ||
| Mycobacterium vanbaalenii PYR-1 | ||||
|
Position: -81
Score: 6.31201 Sequence: TAATGATAATCATTTTCAATA
Position: -25
Score: 5.24684 Sequence: TAATGAAAACGGTTATCGTTG
Locus tag: Mvan_5320
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Mvan_5319
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Mvan_5318
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| znuA-znuC-znuB | -81 | 6.3 | TAATGATAATCATTTTCAATA | Mvan_5320 |
| -25 | 5.2 | TAATGAAAACGGTTATCGTTG | ||