Orthologous regulated operons containing bluB gene
| Regulog: | Zur - Mycobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Mycobacterium smegmatis str. MC2 155 | ||||
|
Position: -31
Score: 5.92825 Sequence: TAATGATAATCGTTTTCAAAA
Locus tag: MSMEG_6052
Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: MSMEG_6053
Name: bluB Funciton: Cobalamin biosynthesis protein BluB @ 5,6-dimethylbenzimidazole synthase, flavin destructase family
Locus tag: MSMEG_6054
Name: lamB Funciton: Conserved hypothetical protein (LamB/YcsF) |
||||
| znuC2-bluB-lamB | -31 | 5.9 | TAATGATAATCGTTTTCAAAA | MSMEG_6052 |