Orthologous regulated operons containing lamB gene

Properties
Regulog:	Zur - Mycobacteriaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Actinobacteria

Built upon 70 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Mycobacterium abscessus ATCC 19977
Position: -43 Score: 6.45345 Sequence: TAATGAAAATCGTTTTCATTA Locus tag: MAB_0577c Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: MAB_0576c Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: MAB_0575c Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: MAB_0574c Name: lamB Funciton: Conserved hypothetical protein (LamB/YcsF)
znuA-znuC-znuB-lamB	-43	6.5	TAATGAAAATCGTTTTCATTA	MAB_0577c
Mycobacterium avium 104
Position: -63 Score: 6.25081 Sequence: TAATGGAAACGATTTTCATTA Locus tag: MAV_0583 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: MAV_0582 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: MAV_0581 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: MAV_0580 Name: lamB Funciton: Conserved hypothetical protein (LamB/YcsF)
znuA-znuC-znuB-lamB	-63	6.3	TAATGGAAACGATTTTCATTA	MAV_0583
Mycobacterium smegmatis str. MC2 155
Position: -31 Score: 5.92825 Sequence: TAATGATAATCGTTTTCAAAA Locus tag: MSMEG_6052 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: MSMEG_6053 Name: bluB Funciton: Cobalamin biosynthesis protein BluB @ 5,6-dimethylbenzimidazole synthase, flavin destructase family Locus tag: MSMEG_6054 Name: lamB Funciton: Conserved hypothetical protein (LamB/YcsF)
znuC2-bluB-lamB	-31	5.9	TAATGATAATCGTTTTCAAAA	MSMEG_6052
Mycobacterium sp. JLS
Position: -2 Score: 6.21096 Sequence: TAATGAAAATCATTTTCAACA Locus tag: Mjls_5111 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Mjls_5112 Name: lamB Funciton: Conserved hypothetical protein (LamB/YcsF)
znuC2-lamB	-2	6.2	TAATGAAAATCATTTTCAACA	Mjls_5111
Mycobacterium vanbaalenii PYR-1
Position: -2 Score: 6.37103 Sequence: TAATGACAATCATTTTCAATA Locus tag: Mvan_5326 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Mvan_5327 Name: lamB Funciton: Conserved hypothetical protein (LamB/YcsF)
znuC2-lamB	-2	6.4	TAATGACAATCATTTTCAATA	Mvan_5326