Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Swoo_1070 gene

Properties
Regulog: Fur - Shewanellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria
Built upon 505 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella woodyi ATCC 51908
Position: -49
Score: 6.16941
Sequence: AAATGATATTAATTCTCATTT
Locus tag: Swoo_1070
Name: Swoo_1070
Funciton: Hypothetical protein
Swoo_1070 -49 6.2 AAATGATATTAATTCTCATTT Swoo_1070
© 2009-2020 RegPrecise