Orthologous regulated operons containing mtrH gene
| Regulog: | Fur - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Shewanella halifaxensis HAW-EB4 | ||||
|
Position: -65
Score: 5.29842 Sequence: AGGTGAGAATAATTCTCATAA
Locus tag: Shal_2783
Name: mtrH Funciton: Surface localized decaheme cytochrome c lipoprotein, MtrH |
||||
| mtrH | -65 | 5.3 | AGGTGAGAATAATTCTCATAA | Shal_2783 |
| Shewanella piezotolerans WP3 | ||||
|
Position: -67
Score: 5.00148 Sequence: AAATGAGATTTGTTCTCAAAC
Locus tag: swp_3277
Name: mtrH Funciton: Surface localized decaheme cytochrome c lipoprotein, MtrH |
||||
| mtrH | -67 | 5 | AAATGAGATTTGTTCTCAAAC | swp_3277 |