Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Sden_0582 gene

Properties
Regulog: Fur - Shewanellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria
Built upon 505 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella denitrificans OS217
Position: -69
Score: 5.34918
Sequence: AAATGATAATGAAAATCATTA
Position: -63
Score: 4.96211
Sequence: TAATGAAAATCATTACCAGTC
Locus tag: Sden_0590
Name: Sden_0590
Funciton: Putative siderophore biosynthesis protein, related to cysteine synthase
Locus tag: Sden_0589
Name: Sden_0589
Funciton: Putative siderophore biosynthesis protein, Ornithine cyclodeaminase (EC 4.3.1.12)
Locus tag: Sden_0588
Name: pvsB
Funciton: Vibrioferrin amide bond forming protein PvsB
Locus tag: Sden_0587
Name: Sden_0587
Funciton: Putative efflux transmembrane protein in siderophore biosynthesys operon
Locus tag: Sden_0586
Name: Sden_0586
Funciton: Siderophore synthetase superfamily, group A / Siderophore synthetase superfamily, group C
Locus tag: Sden_0585
Name: null
Funciton: Putative siderophore biosynthesis protein, HpcH/HpaI aldolase family
Locus tag: Sden_0584
Name: pvsE
Funciton: Vibrioferrin biosynthesis protein, PvsE
Locus tag: Sden_0583
Name: Sden_0583
Funciton: ParB-like nuclease
Locus tag: Sden_0582
Name: Sden_0582
Funciton: Outer membrane receptor proteins, likely involved in siderophore uptake
Sden_0590-Sden_0589-pvsB-Sden_0587-Sden_0586-Sden_0585-pvsE-Sden_0583-Sden_0582 -69 5.3 AAATGATAATGAAAATCATTA Sden_0590
-63 5 TAATGAAAATCATTACCAGTC
© 2009-2020 RegPrecise