Orthologous regulated operons containing pvsB gene

Properties
Regulog:	Fur - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria

Built upon 505 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella denitrificans OS217
Position: -69 Score: 5.34918 Sequence: AAATGATAATGAAAATCATTA Position: -63 Score: 4.96211 Sequence: TAATGAAAATCATTACCAGTC Locus tag: Sden_0590 Name: Sden_0590 Funciton: Putative siderophore biosynthesis protein, related to cysteine synthase Locus tag: Sden_0589 Name: Sden_0589 Funciton: Putative siderophore biosynthesis protein, Ornithine cyclodeaminase (EC 4.3.1.12) Locus tag: Sden_0588 Name: pvsB Funciton: Vibrioferrin amide bond forming protein PvsB Locus tag: Sden_0587 Name: Sden_0587 Funciton: Putative efflux transmembrane protein in siderophore biosynthesys operon Locus tag: Sden_0586 Name: Sden_0586 Funciton: Siderophore synthetase superfamily, group A / Siderophore synthetase superfamily, group C Locus tag: Sden_0585 Name: null Funciton: Putative siderophore biosynthesis protein, HpcH/HpaI aldolase family Locus tag: Sden_0584 Name: pvsE Funciton: Vibrioferrin biosynthesis protein, PvsE Locus tag: Sden_0583 Name: Sden_0583 Funciton: ParB-like nuclease Locus tag: Sden_0582 Name: Sden_0582 Funciton: Outer membrane receptor proteins, likely involved in siderophore uptake
Sden_0590-Sden_0589-pvsB-Sden_0587-Sden_0586-Sden_0585-pvsE-Sden_0583-Sden_0582	-69	5.3	AAATGATAATGAAAATCATTA	Sden_0590
	-63	5	TAATGAAAATCATTACCAGTC
Shewanella piezotolerans WP3
Position: -271 Score: 5.04171 Sequence: GGATGCCAATTGTTCTCATTT Position: -111 Score: 5.55366 Sequence: AAATCGTAATAATTATCATTT Locus tag: swp_0085 Name: pvsA Funciton: Vibrioferrin ligase/carboxylase protein PvsA Locus tag: swp_0086 Name: pvsB Funciton: Vibrioferrin amide bond forming protein PvsB Locus tag: swp_0087 Name: pvsC Funciton: Vibrioferrin membrane-spanning transport protein PvsC Locus tag: swp_0088 Name: pvsD Funciton: Vibrioferrin biosynthesis protein, PvsD Locus tag: swp_0089 Name: pvsE Funciton: Vibrioferrin biosynthesis protein, PvsE
pvsA-pvsB-pvsC-pvsD-pvsE	-271	5	GGATGCCAATTGTTCTCATTT	swp_0085
	-111	5.6	AAATCGTAATAATTATCATTT