Orthologous regulated operons containing swp_3303 gene
| Regulog: | Fur - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Shewanella piezotolerans WP3 | ||||
|
Position: -155
Score: 5.18069 Sequence: TATTGATAGCAATTCTCATTA
Locus tag: swp_3303
Name: swp_3303 Funciton: TonB-dependent siderophore receptor |
||||
| swp_3303 | -155 | 5.2 | TATTGATAGCAATTCTCATTA | swp_3303 |