Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing swp_3303 gene

Properties
Regulog: Fur - Shewanellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria
Built upon 505 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella piezotolerans WP3
Position: -155
Score: 5.18069
Sequence: TATTGATAGCAATTCTCATTA
Locus tag: swp_3303
Name: swp_3303
Funciton: TonB-dependent siderophore receptor
swp_3303 -155 5.2 TATTGATAGCAATTCTCATTA swp_3303
© 2009-2020 RegPrecise