Orthologous regulated operons containing hmuD gene

Properties
Regulog:	Fur - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria

Built upon 505 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella denitrificans OS217
Position: -66 Score: 6.468 Sequence: AAATGAAAATCATTATCATTT Locus tag: Sden_0789 Name: tonB Funciton: TonB mediated energy transduction system, energy transducer component, TonB Locus tag: Sden_0788 Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB Locus tag: Sden_0787 Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD Locus tag: Sden_0786 Name: hmuB Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB Locus tag: Sden_0785 Name: hmuC Funciton: ABC hemin transporter, inner membrane subunit, HmuC Locus tag: Sden_0784 Name: hmuD Funciton: ABC hemin transporter, ATPase subunit, HmuD
tonB-exbB-exbD-hmuB-hmuC-hmuD	-66	6.5	AAATGAAAATCATTATCATTT	Sden_0789
Shewanella halifaxensis HAW-EB4
Position: -207 Score: 6.468 Sequence: AAATGAAAATCATTATCATTT Locus tag: Shal_3400 Name: tonB Funciton: TonB mediated energy transduction system, energy transducer component, TonB Locus tag: Shal_3401 Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB Locus tag: Shal_3402 Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD Locus tag: Shal_3403 Name: hmuB Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB Locus tag: Shal_3404 Name: hmuC Funciton: ABC hemin transporter, inner membrane subunit, HmuC Locus tag: Shal_3405 Name: hmuD Funciton: ABC hemin transporter, ATPase subunit, HmuD
tonB-exbB-exbD-hmuB-hmuC-hmuD	-207	6.5	AAATGAAAATCATTATCATTT	Shal_3400
Shewanella oneidensis MR-1
Position: -97 Score: 5.72154 Sequence: AAATAGAAATCATTATCATTT Locus tag: SO3670 Name: tonB Funciton: TonB mediated energy transduction system, energy transducer component, TonB Locus tag: SO3671 Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB Locus tag: SO3672 Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD Locus tag: SO3673 Name: hmuB Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB Locus tag: SO3674 Name: hmuC Funciton: ABC hemin transporter, inner membrane subunit, HmuC Locus tag: SO_3675 Name: hmuD Funciton: ABC hemin transporter, ATPase subunit, HmuD
tonB-exbB-exbD-hmuB-hmuC-hmuD	-97	5.7	AAATAGAAATCATTATCATTT	SO3670
Shewanella pealeana ATCC 700345
Position: -206 Score: 6.468 Sequence: AAATGAAAATCATTATCATTT Locus tag: Spea_3328 Name: tonB Funciton: TonB mediated energy transduction system, energy transducer component, TonB Locus tag: Spea_3329 Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB Locus tag: Spea_3330 Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD Locus tag: Spea_3331 Name: hmuB Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB Locus tag: Spea_3332 Name: hmuC Funciton: ABC hemin transporter, inner membrane subunit, HmuC Locus tag: Spea_3333 Name: hmuD Funciton: ABC hemin transporter, ATPase subunit, HmuD
tonB-exbB-exbD-hmuB-hmuC-hmuD	-206	6.5	AAATGAAAATCATTATCATTT	Spea_3328
Shewanella piezotolerans WP3
Position: -183 Score: 6.468 Sequence: AAATGAAAATCATTATCATTT Locus tag: swp_3979 Name: tonB Funciton: TonB mediated energy transduction system, energy transducer component, TonB Locus tag: swp_3980 Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB Locus tag: swp_3981 Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD Locus tag: swp_3982 Name: hmuB Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB Locus tag: swp_3983 Name: hmuC Funciton: ABC hemin transporter, inner membrane subunit, HmuC Locus tag: swp_3984 Name: hmuD Funciton: ABC hemin transporter, ATPase subunit, HmuD
tonB-exbB-exbD-hmuB-hmuC-hmuD	-183	6.5	AAATGAAAATCATTATCATTT	swp_3979
Shewanella putrefaciens CN-32
Position: -31 Score: 5.18715 Sequence: AAATGATAATTATCATGATTA Locus tag: Sputcn32_0964 Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB Locus tag: Sputcn32_0963 Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD Locus tag: Sputcn32_0962 Name: hmuB Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB Locus tag: Sputcn32_0961 Name: hmuC Funciton: ABC hemin transporter, inner membrane subunit, HmuC Locus tag: Sputcn32_0960 Name: hmuD Funciton: ABC hemin transporter, ATPase subunit, HmuD
exbB-exbD-hmuB-hmuC-hmuD	-31	5.2	AAATGATAATTATCATGATTA	Sputcn32_0964
Shewanella sp ANA-3
Position: -98 Score: 6.01763 Sequence: AAATGGAAATCATTATCATTT Locus tag: Shewana3_3236 Name: tonB Funciton: TonB mediated energy transduction system, energy transducer component, TonB Locus tag: Shewana3_3237 Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB Locus tag: Shewana3_3238 Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD Locus tag: Shewana3_3239 Name: hmuB Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB Locus tag: Shewana3_3240 Name: hmuC Funciton: ABC hemin transporter, inner membrane subunit, HmuC Locus tag: Shewana3_3241 Name: hmuD Funciton: ABC hemin transporter, ATPase subunit, HmuD
tonB-exbB-exbD-hmuB-hmuC-hmuD	-98	6	AAATGGAAATCATTATCATTT	Shewana3_3236
Shewanella woodyi ATCC 51908
Position: -80 Score: 6.468 Sequence: AAATGAAAATCATTATCATTT Locus tag: Swoo_4005 Name: tonB Funciton: TonB mediated energy transduction system, energy transducer component, TonB Locus tag: Swoo_4006 Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB Locus tag: Swoo_4007 Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD Locus tag: Swoo_4008 Name: hmuB Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB Locus tag: Swoo_4009 Name: hmuC Funciton: ABC hemin transporter, inner membrane subunit, HmuC Locus tag: Swoo_4010 Name: hmuD Funciton: ABC hemin transporter, ATPase subunit, HmuD
tonB-exbB-exbD-hmuB-hmuC-hmuD	-80	6.5	AAATGAAAATCATTATCATTT	Swoo_4005

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing hmuD gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --