Orthologous regulated operons containing exbD gene
Regulog: | Fur - Shewanellaceae |
Regulator type: | Transcription factor |
Regulator family: | FUR |
Regulation mode: | repressor (activator) |
Biological process: | Iron homeostasis |
Effector: | Iron ion, (Fe2+) |
Phylum: | Proteobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Shewanella baltica OS155 | ||||
Position: -63
Score: 6.10539 Sequence: AAATGCAAATCATTATCATTT
Locus tag: Sbal_0951
Name: tonB Funciton: TonB mediated energy transduction system, energy transducer component, TonB
Locus tag: Sbal_0950
Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB
Locus tag: Sbal_0949
Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD |
||||
tonB-exbB-exbD | -63 | 6.1 | AAATGCAAATCATTATCATTT | Sbal_0951 |
Shewanella denitrificans OS217 | ||||
Position: -66
Score: 6.468 Sequence: AAATGAAAATCATTATCATTT
Locus tag: Sden_0789
Name: tonB Funciton: TonB mediated energy transduction system, energy transducer component, TonB
Locus tag: Sden_0788
Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB
Locus tag: Sden_0787
Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD
Locus tag: Sden_0786
Name: hmuB Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
Locus tag: Sden_0785
Name: hmuC Funciton: ABC hemin transporter, inner membrane subunit, HmuC
Locus tag: Sden_0784
Name: hmuD Funciton: ABC hemin transporter, ATPase subunit, HmuD |
||||
tonB-exbB-exbD-hmuB-hmuC-hmuD | -66 | 6.5 | AAATGAAAATCATTATCATTT | Sden_0789 |
Shewanella halifaxensis HAW-EB4 | ||||
Position: -207
Score: 6.468 Sequence: AAATGAAAATCATTATCATTT
Locus tag: Shal_3400
Name: tonB Funciton: TonB mediated energy transduction system, energy transducer component, TonB
Locus tag: Shal_3401
Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB
Locus tag: Shal_3402
Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD
Locus tag: Shal_3403
Name: hmuB Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
Locus tag: Shal_3404
Name: hmuC Funciton: ABC hemin transporter, inner membrane subunit, HmuC
Locus tag: Shal_3405
Name: hmuD Funciton: ABC hemin transporter, ATPase subunit, HmuD |
||||
tonB-exbB-exbD-hmuB-hmuC-hmuD | -207 | 6.5 | AAATGAAAATCATTATCATTT | Shal_3400 |
Shewanella oneidensis MR-1 | ||||
Position: -97
Score: 5.72154 Sequence: AAATAGAAATCATTATCATTT
Locus tag: SO3670
Name: tonB Funciton: TonB mediated energy transduction system, energy transducer component, TonB
Locus tag: SO3671
Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB
Locus tag: SO3672
Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD
Locus tag: SO3673
Name: hmuB Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
Locus tag: SO3674
Name: hmuC Funciton: ABC hemin transporter, inner membrane subunit, HmuC
Locus tag: SO_3675
Name: hmuD Funciton: ABC hemin transporter, ATPase subunit, HmuD |
||||
tonB-exbB-exbD-hmuB-hmuC-hmuD | -97 | 5.7 | AAATAGAAATCATTATCATTT | SO3670 |
Shewanella pealeana ATCC 700345 | ||||
Position: -206
Score: 6.468 Sequence: AAATGAAAATCATTATCATTT
Locus tag: Spea_3328
Name: tonB Funciton: TonB mediated energy transduction system, energy transducer component, TonB
Locus tag: Spea_3329
Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB
Locus tag: Spea_3330
Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD
Locus tag: Spea_3331
Name: hmuB Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
Locus tag: Spea_3332
Name: hmuC Funciton: ABC hemin transporter, inner membrane subunit, HmuC
Locus tag: Spea_3333
Name: hmuD Funciton: ABC hemin transporter, ATPase subunit, HmuD |
||||
tonB-exbB-exbD-hmuB-hmuC-hmuD | -206 | 6.5 | AAATGAAAATCATTATCATTT | Spea_3328 |
Shewanella piezotolerans WP3 | ||||
Position: -183
Score: 6.468 Sequence: AAATGAAAATCATTATCATTT
Locus tag: swp_3979
Name: tonB Funciton: TonB mediated energy transduction system, energy transducer component, TonB
Locus tag: swp_3980
Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB
Locus tag: swp_3981
Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD
Locus tag: swp_3982
Name: hmuB Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
Locus tag: swp_3983
Name: hmuC Funciton: ABC hemin transporter, inner membrane subunit, HmuC
Locus tag: swp_3984
Name: hmuD Funciton: ABC hemin transporter, ATPase subunit, HmuD |
||||
tonB-exbB-exbD-hmuB-hmuC-hmuD | -183 | 6.5 | AAATGAAAATCATTATCATTT | swp_3979 |
Shewanella putrefaciens CN-32 | ||||
Position: -31
Score: 5.18715 Sequence: AAATGATAATTATCATGATTA
Locus tag: Sputcn32_0964
Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB
Locus tag: Sputcn32_0963
Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD
Locus tag: Sputcn32_0962
Name: hmuB Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
Locus tag: Sputcn32_0961
Name: hmuC Funciton: ABC hemin transporter, inner membrane subunit, HmuC
Locus tag: Sputcn32_0960
Name: hmuD Funciton: ABC hemin transporter, ATPase subunit, HmuD |
||||
exbB-exbD-hmuB-hmuC-hmuD | -31 | 5.2 | AAATGATAATTATCATGATTA | Sputcn32_0964 |
Shewanella sp ANA-3 | ||||
Position: -98
Score: 6.01763 Sequence: AAATGGAAATCATTATCATTT
Locus tag: Shewana3_3236
Name: tonB Funciton: TonB mediated energy transduction system, energy transducer component, TonB
Locus tag: Shewana3_3237
Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB
Locus tag: Shewana3_3238
Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD
Locus tag: Shewana3_3239
Name: hmuB Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
Locus tag: Shewana3_3240
Name: hmuC Funciton: ABC hemin transporter, inner membrane subunit, HmuC
Locus tag: Shewana3_3241
Name: hmuD Funciton: ABC hemin transporter, ATPase subunit, HmuD |
||||
tonB-exbB-exbD-hmuB-hmuC-hmuD | -98 | 6 | AAATGGAAATCATTATCATTT | Shewana3_3236 |
Shewanella sp W3-18-1 | ||||
Position: -31
Score: 5.18715 Sequence: AAATGATAATTATCATGATTA
Locus tag: Sputw3181_3203
Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB
Locus tag: Sputw3181_3204
Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD |
||||
exbB-exbD | -31 | 5.2 | AAATGATAATTATCATGATTA | Sputw3181_3203 |
Shewanella woodyi ATCC 51908 | ||||
Position: -80
Score: 6.468 Sequence: AAATGAAAATCATTATCATTT
Locus tag: Swoo_4005
Name: tonB Funciton: TonB mediated energy transduction system, energy transducer component, TonB
Locus tag: Swoo_4006
Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB
Locus tag: Swoo_4007
Name: exbD Funciton: TonB mediated energy transduction system, inner membrane component, ExbD
Locus tag: Swoo_4008
Name: hmuB Funciton: ABC hemin transporter, periplasmic ligand-binding subunit, HmuB
Locus tag: Swoo_4009
Name: hmuC Funciton: ABC hemin transporter, inner membrane subunit, HmuC
Locus tag: Swoo_4010
Name: hmuD Funciton: ABC hemin transporter, ATPase subunit, HmuD |
||||
tonB-exbB-exbD-hmuB-hmuC-hmuD | -80 | 6.5 | AAATGAAAATCATTATCATTT | Swoo_4005 |