Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Shewmr4_0531 gene

Properties
Regulog: Fur - Shewanellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria
Built upon 505 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella sp MR-4
Position: -145
Score: 5.68847
Sequence: AAATGATAATTATTTACATTA
Locus tag: Shewmr4_0531
Name: null
Funciton: TonB-dependent siderophore receptor
Shewmr4_0531 -145 5.7 AAATGATAATTATTTACATTA Shewmr4_0531
Shewanella sp MR-7
Position: -145
Score: 5.68847
Sequence: AAATGATAATTATTTACATTA
Locus tag: Shewmr7_3500
Name: null
Funciton: TonB-dependent siderophore receptor
Shewmr7_3500 -145 5.7 AAATGATAATTATTTACATTA Shewmr7_3500
© 2009-2020 RegPrecise