Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Sputcn32_3636 gene

Properties
Regulog: Fur - Shewanellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria
Built upon 505 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella putrefaciens CN-32
Position: -77
Score: 5.30052
Sequence: TAATGTTAATCATTATCATTC
Locus tag: Sputcn32_3636
Name: null
Funciton: TonB-dependent receptor
Sputcn32_3636 -77 5.3 TAATGTTAATCATTATCATTC Sputcn32_3636
Shewanella sp W3-18-1
Position: -77
Score: 5.30052
Sequence: TAATGTTAATCATTATCATTC
Locus tag: Sputw3181_3776
Name: null
Funciton: TonB-dependent receptor
Sputw3181_3776 -77 5.3 TAATGTTAATCATTATCATTC Sputw3181_3776
© 2009-2020 RegPrecise