Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Sputcn32_3671 gene

Properties
Regulog: Fur - Shewanellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria
Built upon 505 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella putrefaciens CN-32
Position: -54
Score: 5.65639
Sequence: AATTGATAACTATTCTCATTG
Locus tag: Sputcn32_3671
Name: null
Funciton: TonB-dependent receptor
Locus tag: Sputcn32_3670
Name: null
Funciton: Transcriptional regulator, TetR family
Locus tag: Sputcn32_3669
Name: null
Funciton: Ferric siderophore ABC transporter, permease protein
Locus tag: Sputcn32_3668
Name: null
Funciton: Ferric siderophore ABC transporter, permease protein
Locus tag: Sputcn32_3667
Name: null
Funciton: Ferric siderophore ABC transporter, ATP-binding protein
Locus tag: Sputcn32_3666
Name: null
Funciton: Putative iron transport protein
Sputcn32_3671-Sputcn32_3670-Sputcn32_3669-Sputcn32_3668-Sputcn32_3667-Sputcn32_3666 -54 5.7 AATTGATAACTATTCTCATTG Sputcn32_3671
Shewanella sp W3-18-1
Position: -53
Score: 5.65639
Sequence: AATTGATAACTATTCTCATTG
Locus tag: Sputw3181_3812
Name: null
Funciton: TonB-dependent receptor
Locus tag: Sputw3181_3811
Name: null
Funciton: Transcriptional regulator, TetR family
Locus tag: Sputw3181_3810
Name: null
Funciton: Ferric siderophore ABC transporter, permease protein
Locus tag: Sputw3181_3809
Name: null
Funciton: Ferric siderophore ABC transporter, permease protein
Locus tag: Sputw3181_3808
Name: null
Funciton: Ferric siderophore ABC transporter, ATP-binding protein
Locus tag: Sputw3181_3807
Name: null
Funciton: Putative iron transport protein
Sputw3181_3812-Sputw3181_3811-Sputw3181_3810-Sputw3181_3809-Sputw3181_3808-Sputw3181_3807 -53 5.7 AATTGATAACTATTCTCATTG Sputw3181_3812