Orthologous regulated operons containing Sputcn32_3671 gene

Properties
Regulog:	Fur - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria

Built upon 505 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella putrefaciens CN-32
Position: -54 Score: 5.65639 Sequence: AATTGATAACTATTCTCATTG Locus tag: Sputcn32_3671 Name: null Funciton: TonB-dependent receptor Locus tag: Sputcn32_3670 Name: null Funciton: Transcriptional regulator, TetR family Locus tag: Sputcn32_3669 Name: null Funciton: Ferric siderophore ABC transporter, permease protein Locus tag: Sputcn32_3668 Name: null Funciton: Ferric siderophore ABC transporter, permease protein Locus tag: Sputcn32_3667 Name: null Funciton: Ferric siderophore ABC transporter, ATP-binding protein Locus tag: Sputcn32_3666 Name: null Funciton: Putative iron transport protein
Sputcn32_3671-Sputcn32_3670-Sputcn32_3669-Sputcn32_3668-Sputcn32_3667-Sputcn32_3666	-54	5.7	AATTGATAACTATTCTCATTG	Sputcn32_3671
Shewanella sp W3-18-1
Position: -53 Score: 5.65639 Sequence: AATTGATAACTATTCTCATTG Locus tag: Sputw3181_3812 Name: null Funciton: TonB-dependent receptor Locus tag: Sputw3181_3811 Name: null Funciton: Transcriptional regulator, TetR family Locus tag: Sputw3181_3810 Name: null Funciton: Ferric siderophore ABC transporter, permease protein Locus tag: Sputw3181_3809 Name: null Funciton: Ferric siderophore ABC transporter, permease protein Locus tag: Sputw3181_3808 Name: null Funciton: Ferric siderophore ABC transporter, ATP-binding protein Locus tag: Sputw3181_3807 Name: null Funciton: Putative iron transport protein
Sputw3181_3812-Sputw3181_3811-Sputw3181_3810-Sputw3181_3809-Sputw3181_3808-Sputw3181_3807	-53	5.7	AATTGATAACTATTCTCATTG	Sputw3181_3812