Orthologous regulated operons containing Sputcn32_1590 gene
| Regulog: | Fur - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Shewanella frigidimarina NCIMB 400 | ||||
|
Position: -75
Score: 5.71032 Sequence: AAATGAGAATAGTTTCCATTA
Locus tag: Sfri_0391
Name: null Funciton: TonB-dependent siderophore receptor |
||||
| Sfri_0391 | -75 | 5.7 | AAATGAGAATAGTTTCCATTA | Sfri_0391 |
| Shewanella putrefaciens CN-32 | ||||
|
Position: -101
Score: 5.96727 Sequence: AAATGAGAATTATTGTCATCT
Locus tag: Sputcn32_1590
Name: null Funciton: TonB-dependent siderophore receptor |
||||
| Sputcn32_1590 | -101 | 6 | AAATGAGAATTATTGTCATCT | Sputcn32_1590 |
| Shewanella sp ANA-3 | ||||
|
Position: -99
Score: 5.96727 Sequence: AAATGAGAATTATTGTCATCT
Locus tag: Shewana3_2551
Name: null Funciton: TonB-dependent siderophore receptor |
||||
| Shewana3_2551 | -99 | 6 | AAATGAGAATTATTGTCATCT | Shewana3_2551 |
| Shewanella sp MR-4 | ||||
|
Position: -98
Score: 6.20627 Sequence: AAATGAGAATTATTGTCATTT
Locus tag: Shewmr4_2386
Name: null Funciton: TonB-dependent siderophore receptor |
||||
| Shewmr4_2386 | -98 | 6.2 | AAATGAGAATTATTGTCATTT | Shewmr4_2386 |
| Shewanella sp MR-7 | ||||
|
Position: -98
Score: 5.54419 Sequence: AAATGAGAATTATTGTCACCT
Locus tag: Shewmr7_2458
Name: null Funciton: TonB-dependent siderophore receptor |
||||
| Shewmr7_2458 | -98 | 5.5 | AAATGAGAATTATTGTCACCT | Shewmr7_2458 |
| Shewanella sp W3-18-1 | ||||
|
Position: -101
Score: 5.96727 Sequence: AAATGAGAATTATTGTCATCT
Locus tag: Sputw3181_2432
Name: null Funciton: TonB-dependent siderophore receptor |
||||
| Sputw3181_2432 | -101 | 6 | AAATGAGAATTATTGTCATCT | Sputw3181_2432 |