Orthologous regulated operons containing piuB gene
| Regulog: | Fur - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Shewanella amazonensis SB2B | ||||
|
Position: -65
Score: 6.03039 Sequence: TAATGATAATTATTTTTATTT
Locus tag: Sama_3412
Name: Sden_3064 Funciton: TonB-dependent receptor
Locus tag: Sama_3413
Name: piuB Funciton: Uncharacterized iron-regulated membrane protein, PiuB |
||||
| Sden_3064-piuB | -65 | 6 | TAATGATAATTATTTTTATTT | Sama_3412 |
| Shewanella denitrificans OS217 | ||||
|
Position: -122
Score: 6.20539 Sequence: AAATAATAATGATTATCATTT
Locus tag: Sden_3064
Name: Sden_3064 Funciton: TonB-dependent receptor
Locus tag: Sden_3065
Name: piuB Funciton: Uncharacterized iron-regulated membrane protein, PiuB |
||||
| Sden_3064-piuB | -122 | 6.2 | AAATAATAATGATTATCATTT | Sden_3064 |
| Shewanella loihica PV-4 | ||||
|
Position: -108
Score: 5.57299 Sequence: GAATGAAATTAATTCTCATTA
Locus tag: Shew_1181
Name: piuB Funciton: Uncharacterized iron-regulated membrane protein, PiuB |
||||
| piuB | -108 | 5.6 | GAATGAAATTAATTCTCATTA | Shew_1181 |