Orthologous regulated operons containing COG3182 gene

Properties
Regulog:	Fur - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria

Built upon 505 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella baltica OS155
Position: -64 Score: 5.43722 Sequence: TATTGATAACAATTTGCATTA Locus tag: Sbal_2134 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein Locus tag: Sbal_2135 Name: Sfri_2547 Funciton: Conserved hypothetical protein
COG3182-Sfri_2547	-64	5.4	TATTGATAACAATTTGCATTA	Sbal_2134
Shewanella frigidimarina NCIMB 400
Position: -184 Score: 5.61222 Sequence: TATTGCTAATGATTATCATTA Position: -107 Score: 5.46857 Sequence: AATTGATAATAATTATCACTC Position: -80 Score: 5.00536 Sequence: TATTGAGATTCGTTATCAATC Locus tag: Sfri_2548 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein Locus tag: Sfri_2547 Name: Sfri_2547 Funciton: Conserved hypothetical protein
COG3182-Sfri_2547	-184	5.6	TATTGCTAATGATTATCATTA	Sfri_2548
	-107	5.5	AATTGATAATAATTATCACTC
	-80	5	TATTGAGATTCGTTATCAATC
Shewanella putrefaciens CN-32
Position: -90 Score: 5.73917 Sequence: AATTGAAAACAATTATCAATA Position: -64 Score: 5.16415 Sequence: TATTGATAACAATTCGTATTA Locus tag: Sputcn32_1842 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein Locus tag: Sputcn32_1843 Name: Sfri_2547 Funciton: Conserved hypothetical protein
COG3182-Sfri_2547	-90	5.7	AATTGAAAACAATTATCAATA	Sputcn32_1842
	-64	5.2	TATTGATAACAATTCGTATTA
Shewanella sp ANA-3
Position: -66 Score: 5.46024 Sequence: TATTGATAACAATTCGCATTA Locus tag: Shewana3_2196 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein Locus tag: Shewana3_2195 Name: Sfri_2547 Funciton: Conserved hypothetical protein
COG3182-Sfri_2547	-66	5.5	TATTGATAACAATTCGCATTA	Shewana3_2196
Shewanella sp MR-4
Position: -65 Score: 5.46024 Sequence: TATTGATAACAATTCGCATTA Locus tag: Shewmr4_2076 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein Locus tag: Shewmr4_2075 Name: Sfri_2547 Funciton: Conserved hypothetical protein
COG3182-Sfri_2547	-65	5.5	TATTGATAACAATTCGCATTA	Shewmr4_2076
Shewanella sp MR-7
Position: -65 Score: 5.46024 Sequence: TATTGATAACAATTCGCATTA Locus tag: Shewmr7_1899 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein Locus tag: Shewmr7_1900 Name: Sfri_2547 Funciton: Conserved hypothetical protein
COG3182-Sfri_2547	-65	5.5	TATTGATAACAATTCGCATTA	Shewmr7_1899
Shewanella sp W3-18-1
Position: -90 Score: 5.73917 Sequence: AATTGAAAACAATTATCAATA Position: -64 Score: 5.16415 Sequence: TATTGATAACAATTCGTATTA Locus tag: Sputw3181_2167 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein Locus tag: Sputw3181_2166 Name: Sfri_2547 Funciton: Conserved hypothetical protein
COG3182-Sfri_2547	-90	5.7	AATTGAAAACAATTATCAATA	Sputw3181_2167
	-64	5.2	TATTGATAACAATTCGTATTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing COG3182 gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --