Orthologous regulated operons containing COG3182 gene

Properties
Regulog:	Fur - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria

Built upon 505 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -84 Score: 5.09989 Sequence: CAATGCGAATCGTTTGCATTT Locus tag: Sama_0589 Name: Sfri_4035 Funciton: Conserved hypothetical signal peptide protein, possibly porin Locus tag: Sama_0588 Name: null Funciton: FMN-binding domain-containing protein Locus tag: Sama_0587 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein
Sfri_4035-Sama_0588-COG3182	-84	5.1	CAATGCGAATCGTTTGCATTT	Sama_0589
Shewanella baltica OS155
Position: -93 Score: 5.43547 Sequence: AAATGCGAATTGTTTGCATTA Locus tag: Sbal_2014 Name: Sfri_4035 Funciton: Conserved hypothetical signal peptide protein, possibly porin Locus tag: Sbal_2015 Name: null Funciton: FMN-binding domain-containing protein Locus tag: Sbal_2016 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein
Sfri_4035-Sbal_2015-COG3182	-93	5.4	AAATGCGAATTGTTTGCATTA	Sbal_2014
Shewanella denitrificans OS217
Position: -91 Score: 5.13938 Sequence: AAATACGAATAGTTTGCATTA Locus tag: Sden_0638 Name: Sfri_4035 Funciton: Conserved hypothetical signal peptide protein, possibly porin Locus tag: Sden_0639 Name: null Funciton: FMN-binding domain-containing protein Locus tag: Sden_0640 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein
Sfri_4035-Sden_0639-COG3182	-91	5.1	AAATACGAATAGTTTGCATTA	Sden_0638
Shewanella frigidimarina NCIMB 400
Position: -106 Score: 5.63942 Sequence: TAATGATAATGGTTTGCATTA Locus tag: Sfri_4035 Name: Sfri_4035 Funciton: Conserved hypothetical signal peptide protein, possibly porin Locus tag: Sfri_4034 Name: null Funciton: FMN-binding domain-containing protein Locus tag: Sfri_4033 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein
Sfri_4035-Sfri_4034-COG3182	-106	5.6	TAATGATAATGGTTTGCATTA	Sfri_4035
Shewanella loihica PV-4
Position: -84 Score: 5.65321 Sequence: TAATGATAATAGTTTGCATTA Locus tag: Shew_3120 Name: Sfri_4035 Funciton: Conserved hypothetical signal peptide protein, possibly porin Locus tag: Shew_3121 Name: null Funciton: FMN-binding domain-containing protein Locus tag: Shew_3122 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein
Sfri_4035-Shew_3121-COG3182	-84	5.7	TAATGATAATAGTTTGCATTA	Shew_3120
Shewanella pealeana ATCC 700345
Position: -82 Score: 5.63942 Sequence: TAATGATAACGATTTGCATTA Locus tag: Spea_0712 Name: Sfri_4035 Funciton: Conserved hypothetical signal peptide protein, possibly porin Locus tag: Spea_0711 Name: null Funciton: FMN-binding domain-containing protein Locus tag: Spea_0710 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein
Sfri_4035-Spea_0711-COG3182	-82	5.6	TAATGATAACGATTTGCATTA	Spea_0712
Shewanella piezotolerans WP3
Position: -81 Score: 5.95341 Sequence: AAATGAGAATAATTTGCATTA Locus tag: swp_4367 Name: Sfri_4035 Funciton: Conserved hypothetical signal peptide protein, possibly porin Locus tag: swp_4368 Name: null Funciton: FMN-binding domain-containing protein Locus tag: swp_4369 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein
Sfri_4035-swp_4368-COG3182	-81	6	AAATGAGAATAATTTGCATTA	swp_4367
Shewanella sediminis HAW-EB3
Position: -83 Score: 5.63942 Sequence: AAATGATAACCGTTTGCATTA Locus tag: Ssed_3889 Name: Sfri_4035 Funciton: Conserved hypothetical signal peptide protein, possibly porin Locus tag: Ssed_3890 Name: null Funciton: FMN-binding domain-containing protein Locus tag: Ssed_3891 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein
Sfri_4035-Ssed_3890-COG3182	-83	5.6	AAATGATAACCGTTTGCATTA	Ssed_3889
Shewanella woodyi ATCC 51908
Position: -83 Score: 5.40091 Sequence: GAATGATAACAATTTGCATTA Locus tag: Swoo_3788 Name: Sfri_4035 Funciton: Conserved hypothetical signal peptide protein, possibly porin Locus tag: Swoo_3789 Name: null Funciton: FMN-binding domain-containing protein Locus tag: Swoo_3790 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein
Sfri_4035-Swoo_3789-COG3182	-83	5.4	GAATGATAACAATTTGCATTA	Swoo_3788

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing COG3182 gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --