Orthologous regulated operons containing piuC gene
Regulog: | Fur - Shewanellaceae |
Regulator type: | Transcription factor |
Regulator family: | FUR |
Regulation mode: | repressor (activator) |
Biological process: | Iron homeostasis |
Effector: | Iron ion, (Fe2+) |
Phylum: | Proteobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Shewanella baltica OS155 | ||||
Position: -108
Score: 4.90053 Sequence: AAATGATAATAGTTATTGATC
Locus tag: Sbal_3635
Name: null Funciton: TonB-dependent siderophore receptor
Locus tag: Sbal_3634
Name: piuC Funciton: Iron-uptake factor PiuC |
||||
Sbal_3635-piuC | -108 | 4.9 | AAATGATAATAGTTATTGATC | Sbal_3635 |
Shewanella frigidimarina NCIMB 400 | ||||
Position: -103
Score: 5.8093 Sequence: AAATGATAATGATTTGTATTT
Locus tag: Sfri_0611
Name: null Funciton: TonB-dependent siderophore receptor
Locus tag: Sfri_0612
Name: piuC Funciton: Iron-uptake factor PiuC |
||||
Sfri_0611-piuC | -103 | 5.8 | AAATGATAATGATTTGTATTT | Sfri_0611 |
Shewanella oneidensis MR-1 | ||||
Position: -108
Score: 5.05585 Sequence: AAATGATAATAATTATTGATC
Locus tag: SO3914
Name: null Funciton: TonB-dependent siderophore receptor
Locus tag: SO3913
Name: piuC Funciton: Iron-uptake factor PiuC |
||||
SO3914-piuC | -108 | 5.1 | AAATGATAATAATTATTGATC | SO3914 |
Shewanella sp ANA-3 | ||||
Position: -107
Score: 5.46348 Sequence: AAATGATAATAATTATTGATT
Locus tag: Shewana3_0716
Name: null Funciton: TonB-dependent siderophore receptor
Locus tag: Shewana3_0717
Name: piuC Funciton: Iron-uptake factor PiuC |
||||
Shewana3_0716-piuC | -107 | 5.5 | AAATGATAATAATTATTGATT | Shewana3_0716 |
Shewanella sp MR-4 | ||||
Position: -106
Score: 5.46348 Sequence: AAATGATAATAATTATTGATT
Locus tag: Shewmr4_3245
Name: null Funciton: TonB-dependent siderophore receptor
Locus tag: Shewmr4_3244
Name: piuC Funciton: Iron-uptake factor PiuC |
||||
Shewmr4_3245-piuC | -106 | 5.5 | AAATGATAATAATTATTGATT | Shewmr4_3245 |
Shewanella sp MR-7 | ||||
Position: -106
Score: 4.80191 Sequence: AAATGATAATAATAATTGATT
Locus tag: Shewmr7_0697
Name: null Funciton: TonB-dependent siderophore receptor
Locus tag: Shewmr7_0698
Name: piuC Funciton: Iron-uptake factor PiuC |
||||
Shewmr7_0697-piuC | -106 | 4.8 | AAATGATAATAATAATTGATT | Shewmr7_0697 |