Orthologous regulated operons containing SO2426 gene
| Regulog: | Fur - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Shewanella amazonensis SB2B | ||||
|
Position: -32
Score: 4.8155 Sequence: GAATAACAACCGTTCGCATTT
Locus tag: Sama_1718
Name: null Funciton: Two component transcriptional regulator, Winged helix family |
||||
| Sama_1718 | -32 | 4.8 | GAATAACAACCGTTCGCATTT | Sama_1718 |
| Shewanella baltica OS155 | ||||
|
Position: -32
Score: 5.1388 Sequence: AAATGATATAGATTCTCGTTT
Locus tag: Sbal_2050
Name: null Funciton: Two component transcriptional regulator, Winged helix family |
||||
| Sbal_2050 | -32 | 5.1 | AAATGATATAGATTCTCGTTT | Sbal_2050 |
| Shewanella denitrificans OS217 | ||||
|
Position: 10
Score: 5.61765 Sequence: TAATGAAAATGGTTATCGTTT
Locus tag: Sden_1906
Name: null Funciton: Two component transcriptional regulator, Winged helix family |
||||
| Sden_1906 | 10 | 5.6 | TAATGAAAATGGTTATCGTTT | Sden_1906 |
| Shewanella frigidimarina NCIMB 400 | ||||
|
Position: -32
Score: 5.58512 Sequence: TAATGGTAATCGTTATCATTA
Locus tag: Sfri_2150
Name: null Funciton: Two component transcriptional regulator, Winged helix family |
||||
| Sfri_2150 | -32 | 5.6 | TAATGGTAATCGTTATCATTA | Sfri_2150 |
| Shewanella halifaxensis HAW-EB4 | ||||
|
Position: -34
Score: 5.61783 Sequence: AAATGAAAATGATTCGCATTG
Locus tag: Shal_2220
Name: null Funciton: Two component transcriptional regulator, Winged helix family |
||||
| Shal_2220 | -34 | 5.6 | AAATGAAAATGATTCGCATTG | Shal_2220 |
| Shewanella loihica PV-4 | ||||
|
Position: -31
Score: 6.0493 Sequence: TAATGATAACTATTATCATTA
Locus tag: Shew_1936
Name: null Funciton: Two component transcriptional regulator, Winged helix family |
||||
| Shew_1936 | -31 | 6 | TAATGATAACTATTATCATTA | Shew_1936 |
| Shewanella oneidensis MR-1 | ||||
|
Position: -2
Score: 5.61591 Sequence: AAATGATATTGATTCTCGTTT
Locus tag: SO2426
Name: null Funciton: Two component transcriptional regulator, Winged helix family |
||||
| SO2426 | -2 | 5.6 | AAATGATATTGATTCTCGTTT | SO2426 |
| Shewanella pealeana ATCC 700345 | ||||
|
Position: -34
Score: 5.31772 Sequence: TAATGCGAATTATTCGTATTT
Locus tag: Spea_2236
Name: null Funciton: Two component transcriptional regulator, Winged helix family |
||||
| Spea_2236 | -34 | 5.3 | TAATGCGAATTATTCGTATTT | Spea_2236 |
| Shewanella piezotolerans WP3 | ||||
|
Position: -9
Score: 5.50977 Sequence: CAATGATAATTGTTCGCATTT
Locus tag: swp_2595
Name: null Funciton: Two component transcriptional regulator, Winged helix family |
||||
| swp_2595 | -9 | 5.5 | CAATGATAATTGTTCGCATTT | swp_2595 |
| Shewanella putrefaciens CN-32 | ||||
|
Position: -2
Score: 5.46058 Sequence: AAATGATATCGATTCTCGTTT
Locus tag: Sputcn32_1941
Name: null Funciton: Two component transcriptional regulator, Winged helix family |
||||
| Sputcn32_1941 | -2 | 5.5 | AAATGATATCGATTCTCGTTT | Sputcn32_1941 |
| Shewanella sediminis HAW-EB3 | ||||
|
Position: -34
Score: 5.53547 Sequence: AAATGATAACAGTTCGTATTT
Locus tag: Ssed_2316
Name: null Funciton: Two component transcriptional regulator, Winged helix family |
||||
| Ssed_2316 | -34 | 5.5 | AAATGATAACAGTTCGTATTT | Ssed_2316 |
| Shewanella sp ANA-3 | ||||
|
Position: -32
Score: 5.61591 Sequence: AAATGATATTGATTCTCGTTT
Locus tag: Shewana3_1959
Name: null Funciton: Two component transcriptional regulator, Winged helix family |
||||
| Shewana3_1959 | -32 | 5.6 | AAATGATATTGATTCTCGTTT | Shewana3_1959 |
| Shewanella sp MR-4 | ||||
|
Position: -32
Score: 5.61591 Sequence: AAATGATATTGATTCTCGTTT
Locus tag: Shewmr4_1904
Name: null Funciton: Two component transcriptional regulator, Winged helix family |
||||
| Shewmr4_1904 | -32 | 5.6 | AAATGATATTGATTCTCGTTT | Shewmr4_1904 |
| Shewanella sp MR-7 | ||||
|
Position: -32
Score: 5.61591 Sequence: AAATGATATTGATTCTCGTTT
Locus tag: Shewmr7_2074
Name: null Funciton: Two component transcriptional regulator, Winged helix family |
||||
| Shewmr7_2074 | -32 | 5.6 | AAATGATATTGATTCTCGTTT | Shewmr7_2074 |
| Shewanella sp W3-18-1 | ||||
|
Position: -2
Score: 5.46058 Sequence: AAATGATATCGATTCTCGTTT
Locus tag: Sputw3181_2064
Name: null Funciton: Two component transcriptional regulator, Winged helix family |
||||
| Sputw3181_2064 | -2 | 5.5 | AAATGATATCGATTCTCGTTT | Sputw3181_2064 |
| Shewanella woodyi ATCC 51908 | ||||
|
Position: -36
Score: 5.37656 Sequence: TGTTGATAATTGTTCGCATTT
Locus tag: Swoo_2294
Name: null Funciton: Two component transcriptional regulator, Winged helix family |
||||
| Swoo_2294 | -36 | 5.4 | TGTTGATAATTGTTCGCATTT | Swoo_2294 |