Orthologous regulated operons containing SO2426 gene

Properties
Regulog:	Fur - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria

Built upon 505 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -32 Score: 4.8155 Sequence: GAATAACAACCGTTCGCATTT Locus tag: Sama_1718 Name: null Funciton: Two component transcriptional regulator, Winged helix family
Sama_1718	-32	4.8	GAATAACAACCGTTCGCATTT	Sama_1718
Shewanella baltica OS155
Position: -32 Score: 5.1388 Sequence: AAATGATATAGATTCTCGTTT Locus tag: Sbal_2050 Name: null Funciton: Two component transcriptional regulator, Winged helix family
Sbal_2050	-32	5.1	AAATGATATAGATTCTCGTTT	Sbal_2050
Shewanella denitrificans OS217
Position: 10 Score: 5.61765 Sequence: TAATGAAAATGGTTATCGTTT Locus tag: Sden_1906 Name: null Funciton: Two component transcriptional regulator, Winged helix family
Sden_1906	10	5.6	TAATGAAAATGGTTATCGTTT	Sden_1906
Shewanella frigidimarina NCIMB 400
Position: -32 Score: 5.58512 Sequence: TAATGGTAATCGTTATCATTA Locus tag: Sfri_2150 Name: null Funciton: Two component transcriptional regulator, Winged helix family
Sfri_2150	-32	5.6	TAATGGTAATCGTTATCATTA	Sfri_2150
Shewanella halifaxensis HAW-EB4
Position: -34 Score: 5.61783 Sequence: AAATGAAAATGATTCGCATTG Locus tag: Shal_2220 Name: null Funciton: Two component transcriptional regulator, Winged helix family
Shal_2220	-34	5.6	AAATGAAAATGATTCGCATTG	Shal_2220
Shewanella loihica PV-4
Position: -31 Score: 6.0493 Sequence: TAATGATAACTATTATCATTA Locus tag: Shew_1936 Name: null Funciton: Two component transcriptional regulator, Winged helix family
Shew_1936	-31	6	TAATGATAACTATTATCATTA	Shew_1936
Shewanella oneidensis MR-1
Position: -2 Score: 5.61591 Sequence: AAATGATATTGATTCTCGTTT Locus tag: SO2426 Name: null Funciton: Two component transcriptional regulator, Winged helix family
SO2426	-2	5.6	AAATGATATTGATTCTCGTTT	SO2426
Shewanella pealeana ATCC 700345
Position: -34 Score: 5.31772 Sequence: TAATGCGAATTATTCGTATTT Locus tag: Spea_2236 Name: null Funciton: Two component transcriptional regulator, Winged helix family
Spea_2236	-34	5.3	TAATGCGAATTATTCGTATTT	Spea_2236
Shewanella piezotolerans WP3
Position: -9 Score: 5.50977 Sequence: CAATGATAATTGTTCGCATTT Locus tag: swp_2595 Name: null Funciton: Two component transcriptional regulator, Winged helix family
swp_2595	-9	5.5	CAATGATAATTGTTCGCATTT	swp_2595
Shewanella putrefaciens CN-32
Position: -2 Score: 5.46058 Sequence: AAATGATATCGATTCTCGTTT Locus tag: Sputcn32_1941 Name: null Funciton: Two component transcriptional regulator, Winged helix family
Sputcn32_1941	-2	5.5	AAATGATATCGATTCTCGTTT	Sputcn32_1941
Shewanella sediminis HAW-EB3
Position: -34 Score: 5.53547 Sequence: AAATGATAACAGTTCGTATTT Locus tag: Ssed_2316 Name: null Funciton: Two component transcriptional regulator, Winged helix family
Ssed_2316	-34	5.5	AAATGATAACAGTTCGTATTT	Ssed_2316
Shewanella sp ANA-3
Position: -32 Score: 5.61591 Sequence: AAATGATATTGATTCTCGTTT Locus tag: Shewana3_1959 Name: null Funciton: Two component transcriptional regulator, Winged helix family
Shewana3_1959	-32	5.6	AAATGATATTGATTCTCGTTT	Shewana3_1959
Shewanella sp MR-4
Position: -32 Score: 5.61591 Sequence: AAATGATATTGATTCTCGTTT Locus tag: Shewmr4_1904 Name: null Funciton: Two component transcriptional regulator, Winged helix family
Shewmr4_1904	-32	5.6	AAATGATATTGATTCTCGTTT	Shewmr4_1904
Shewanella sp MR-7
Position: -32 Score: 5.61591 Sequence: AAATGATATTGATTCTCGTTT Locus tag: Shewmr7_2074 Name: null Funciton: Two component transcriptional regulator, Winged helix family
Shewmr7_2074	-32	5.6	AAATGATATTGATTCTCGTTT	Shewmr7_2074
Shewanella sp W3-18-1
Position: -2 Score: 5.46058 Sequence: AAATGATATCGATTCTCGTTT Locus tag: Sputw3181_2064 Name: null Funciton: Two component transcriptional regulator, Winged helix family
Sputw3181_2064	-2	5.5	AAATGATATCGATTCTCGTTT	Sputw3181_2064
Shewanella woodyi ATCC 51908
Position: -36 Score: 5.37656 Sequence: TGTTGATAATTGTTCGCATTT Locus tag: Swoo_2294 Name: null Funciton: Two component transcriptional regulator, Winged helix family
Swoo_2294	-36	5.4	TGTTGATAATTGTTCGCATTT	Swoo_2294

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing SO2426 gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --