Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing SO3408 gene

Properties
Regulog: Fur - Shewanellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria
Built upon 505 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -72
Score: 5.79792
Sequence: AATTGAGAATGTTTATCATTT
Locus tag: Sama_3409
Name: null
Funciton: Conserved hypothetical protein
Locus tag: Sama_3410
Name: null
Funciton: Iron-regulated membrane protein
Locus tag: Sama_3411
Name: null
Funciton: Conserved hypothetical inner membrane protein
Sama_3409-Sama_3410-Sama_3411 -72 5.8 AATTGAGAATGTTTATCATTT Sama_3409
Shewanella baltica OS155
Position: -195
Score: 5.53364
Sequence: AAATGATATCGTTTATCATTT
Locus tag: Sbal_1237
Name: null
Funciton: Conserved hypothetical protein
Locus tag: Sbal_1236
Name: null
Funciton: Iron-regulated membrane protein
Locus tag: Sbal_1235
Name: null
Funciton: Conserved hypothetical inner membrane protein
Sbal_1237-Sbal_1236-Sbal_1235 -195 5.5 AAATGATATCGTTTATCATTT Sbal_1237
Shewanella denitrificans OS217
Position: -75
Score: 5.24099
Sequence: GAATAAAAACAGTTCTCAATT
Locus tag: Sden_2355
Name: null
Funciton: Conserved hypothetical protein
Locus tag: Sden_2356
Name: null
Funciton: Iron-regulated membrane protein
Locus tag: Sden_2357
Name: null
Funciton: Conserved hypothetical inner membrane protein
Sden_2355-Sden_2356-Sden_2357 -75 5.2 GAATAAAAACAGTTCTCAATT Sden_2355
Shewanella halifaxensis HAW-EB4
Position: -96
Score: 5.07291
Sequence: GAATGGAAACGGTTCTCAATT
Locus tag: Shal_1257
Name: null
Funciton: Conserved hypothetical protein
Locus tag: Shal_1256
Name: null
Funciton: Iron-regulated membrane protein
Locus tag: Shal_1255
Name: null
Funciton: Conserved hypothetical inner membrane protein
Shal_1257-Shal_1256-Shal_1255 -96 5.1 GAATGGAAACGGTTCTCAATT Shal_1257
Shewanella loihica PV-4
Position: -63
Score: 4.49479
Sequence: GAATGAGAACCTATCTCAACA
Locus tag: Shew_1240
Name: null
Funciton: Conserved hypothetical protein
Locus tag: Shew_1239
Name: null
Funciton: Iron-regulated membrane protein
Locus tag: Shew_1238
Name: null
Funciton: Conserved hypothetical inner membrane protein
Shew_1240-Shew_1239-Shew_1238 -63 4.5 GAATGAGAACCTATCTCAACA Shew_1240
Shewanella oneidensis MR-1
Position: -273
Score: 5.68896
Sequence: AAATGATATTGTTTATCATTT
Locus tag: SO3406
Name: null
Funciton: Conserved hypothetical protein
Locus tag: SO3407
Name: null
Funciton: Iron-regulated membrane protein
Locus tag: SO3408
Name: null
Funciton: Conserved hypothetical inner membrane protein
SO3406-SO3407-SO3408 -273 5.7 AAATGATATTGTTTATCATTT SO3406
Shewanella pealeana ATCC 700345
Position: -82
Score: 5.27096
Sequence: GAATGAAAACAGTTATCAGTT
Locus tag: Spea_1223
Name: null
Funciton: Conserved hypothetical protein
Locus tag: Spea_1222
Name: null
Funciton: Iron-regulated membrane protein
Locus tag: Spea_1221
Name: null
Funciton: Conserved hypothetical inner membrane protein
Spea_1223-Spea_1222-Spea_1221 -82 5.3 GAATGAAAACAGTTATCAGTT Spea_1223
Shewanella piezotolerans WP3
Position: -91
Score: 5.23765
Sequence: GAATAAAAATGGTTATCAATA
Locus tag: swp_3413
Name: null
Funciton: Conserved hypothetical protein
Locus tag: swp_3414
Name: null
Funciton: Iron-regulated membrane protein
Locus tag: swp_3415
Name: null
Funciton: Conserved hypothetical inner membrane protein
swp_3413-swp_3414-swp_3415 -91 5.2 GAATAAAAATGGTTATCAATA swp_3413
Shewanella putrefaciens CN-32
Position: -196
Score: 5.53364
Sequence: AAATGATATCGTTTATCATTT
Locus tag: Sputcn32_2727
Name: null
Funciton: Conserved hypothetical protein
Locus tag: Sputcn32_2728
Name: null
Funciton: Iron-regulated membrane protein
Locus tag: Sputcn32_2729
Name: null
Funciton: Conserved hypothetical inner membrane protein
Sputcn32_2727-Sputcn32_2728-Sputcn32_2729 -196 5.5 AAATGATATCGTTTATCATTT Sputcn32_2727
Shewanella sediminis HAW-EB3
Position: -98
Score: 5.08765
Sequence: GAATGAAAACGGTTATCACCT
Locus tag: Ssed_1345
Name: null
Funciton: Conserved hypothetical protein
Locus tag: Ssed_1344
Name: null
Funciton: Iron-regulated membrane protein
Locus tag: Ssed_1343
Name: null
Funciton: Conserved hypothetical inner membrane protein
Ssed_1345-Ssed_1344-Ssed_1343 -98 5.1 GAATGAAAACGGTTATCACCT Ssed_1345
Shewanella sp ANA-3
Position: -177
Score: 5.68896
Sequence: AAATGATATTGTTTATCATTT
Locus tag: Shewana3_1149
Name: null
Funciton: Conserved hypothetical protein
Locus tag: Shewana3_1148
Name: null
Funciton: Iron-regulated membrane protein
Locus tag: Shewana3_1147
Name: null
Funciton: Conserved hypothetical inner membrane protein
Shewana3_1149-Shewana3_1148-Shewana3_1147 -177 5.7 AAATGATATTGTTTATCATTT Shewana3_1149
Shewanella sp MR-4
Position: -177
Score: 5.68896
Sequence: AAATGATATTGTTTATCATTT
Locus tag: Shewmr4_1148
Name: null
Funciton: Conserved hypothetical protein
Locus tag: Shewmr4_1147
Name: null
Funciton: Iron-regulated membrane protein
Locus tag: Shewmr4_1146
Name: null
Funciton: Conserved hypothetical inner membrane protein
Shewmr4_1148-Shewmr4_1147-Shewmr4_1146 -177 5.7 AAATGATATTGTTTATCATTT Shewmr4_1148
Shewanella sp MR-7
Position: -177
Score: 5.68896
Sequence: AAATGATATTGTTTATCATTT
Locus tag: Shewmr7_1219
Name: null
Funciton: Conserved hypothetical protein
Locus tag: Shewmr7_1218
Name: null
Funciton: Iron-regulated membrane protein
Locus tag: Shewmr7_1217
Name: null
Funciton: Conserved hypothetical inner membrane protein
Shewmr7_1219-Shewmr7_1218-Shewmr7_1217 -177 5.7 AAATGATATTGTTTATCATTT Shewmr7_1219
Shewanella sp W3-18-1
Position: -196
Score: 5.53364
Sequence: AAATGATATCGTTTATCATTT
Locus tag: Sputw3181_1285
Name: null
Funciton: Conserved hypothetical protein
Locus tag: Sputw3181_1284
Name: null
Funciton: Iron-regulated membrane protein
Locus tag: Sputw3181_1283
Name: null
Funciton: Conserved hypothetical inner membrane protein
Sputw3181_1285-Sputw3181_1284-Sputw3181_1283 -196 5.5 AAATGATATCGTTTATCATTT Sputw3181_1285
Shewanella woodyi ATCC 51908
Position: -96
Score: 5.69549
Sequence: AAATAAAAACCGTTCTCATTA
Locus tag: Swoo_3307
Name: null
Funciton: Conserved hypothetical protein
Locus tag: Swoo_3308
Name: null
Funciton: Iron-regulated membrane protein
Locus tag: Swoo_3309
Name: null
Funciton: Conserved hypothetical inner membrane protein
Swoo_3307-Swoo_3308-Swoo_3309 -96 5.7 AAATAAAAACCGTTCTCATTA Swoo_3307
© 2009-2020 RegPrecise