Orthologous regulated operons containing SO2039 gene

Properties
Regulog:	Fur - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria

Built upon 505 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -42 Score: 5.46268 Sequence: TAATGAGATTTATTTGCATTA Locus tag: Sama_1896 Name: null Funciton: Signalling protein with EAL domain
Sama_1896	-42	5.5	TAATGAGATTTATTTGCATTA	Sama_1896
Shewanella baltica OS155
Position: -46 Score: 5.32818 Sequence: AAATGCGAATAATTAGTATTA Locus tag: Sbal_4560 Name: null Funciton: Signalling protein with EAL domain
Sbal_4560	-46	5.3	AAATGCGAATAATTAGTATTA	Sbal_4560
Shewanella denitrificans OS217
Position: -44 Score: 5.24041 Sequence: AAATAGGAATAATTAGCATTA Locus tag: Sden_1592 Name: null Funciton: Signalling protein with EAL domain
Sden_1592	-44	5.2	AAATAGGAATAATTAGCATTA	Sden_1592
Shewanella halifaxensis HAW-EB4
Position: -35 Score: 5.23706 Sequence: TAATATAAACAATTATCATTT Locus tag: Shal_1861 Name: null Funciton: Signalling protein with EAL domain
Shal_1861	-35	5.2	TAATATAAACAATTATCATTT	Shal_1861
Shewanella oneidensis MR-1
Position: -44 Score: 5.5636 Sequence: AAATGCGAATAATTAGCAATT Locus tag: SO2039 Name: null Funciton: Signalling protein with EAL domain
SO2039	-44	5.6	AAATGCGAATAATTAGCAATT	SO2039
Shewanella piezotolerans WP3
Position: 29 Score: 5.56661 Sequence: TAATGTTAATAATTATCATTA Locus tag: swp_2763 Name: null Funciton: Signalling protein with EAL domain
swp_2763	29	5.6	TAATGTTAATAATTATCATTA	swp_2763
Shewanella putrefaciens CN-32
Position: -48 Score: 4.87901 Sequence: AAATGCAAATAATAAGCAATT Locus tag: Sputcn32_2106 Name: null Funciton: Signalling protein with EAL domain
Sputcn32_2106	-48	4.9	AAATGCAAATAATAAGCAATT	Sputcn32_2106
Shewanella sediminis HAW-EB3
Position: -56 Score: 4.96502 Sequence: TAATGTGAATAATTACTATTT Locus tag: Ssed_1968 Name: null Funciton: Signalling protein with EAL domain
Ssed_1968	-56	5	TAATGTGAATAATTACTATTT	Ssed_1968
Shewanella sp ANA-3
Position: -44 Score: 5.02389 Sequence: AAATGCGAATAATTAGCGATT Locus tag: Shewana3_2237 Name: null Funciton: Signalling protein with EAL domain
Shewana3_2237	-44	5	AAATGCGAATAATTAGCGATT	Shewana3_2237
Shewanella sp MR-4
Position: -42 Score: 5.02389 Sequence: AAATGCGAATAATTAGCGATT Locus tag: Shewmr4_2112 Name: null Funciton: Signalling protein with EAL domain
Shewmr4_2112	-42	5	AAATGCGAATAATTAGCGATT	Shewmr4_2112
Shewanella sp MR-7
Position: -44 Score: 5.5636 Sequence: AAATGCGAATAATTAGCAATT Locus tag: Shewmr7_1862 Name: null Funciton: Signalling protein with EAL domain
Shewmr7_1862	-44	5.6	AAATGCGAATAATTAGCAATT	Shewmr7_1862
Shewanella sp W3-18-1
Position: -48 Score: 4.87901 Sequence: AAATGCAAATAATAAGCAATT Locus tag: Sputw3181_1906 Name: null Funciton: Signalling protein with EAL domain
Sputw3181_1906	-48	4.9	AAATGCAAATAATAAGCAATT	Sputw3181_1906

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing SO2039 gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --