Orthologous regulated operons containing SO0797 gene

Properties
Regulog:	Fur - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria

Built upon 505 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella oneidensis MR-1
Position: -62 Score: 6.05341 Sequence: AAATAATAACAATTCTCATTT Locus tag: SO0798 Name: null Funciton: TonB-dependent outer membrane receptor Locus tag: SO0797 Name: null Funciton: Periplasmic thioredoxin-family protein
SO0798-SO0797	-62	6.1	AAATAATAACAATTCTCATTT	SO0798
Shewanella putrefaciens CN-32
Position: -62 Score: 5.63199 Sequence: AAATAATAACCATTCTCATTC Locus tag: Sputcn32_3191 Name: null Funciton: TonB-dependent outer membrane receptor Locus tag: Sputcn32_3192 Name: null Funciton: Periplasmic thioredoxin-family protein
Sputcn32_3191-Sputcn32_3192	-62	5.6	AAATAATAACCATTCTCATTC	Sputcn32_3191
Shewanella sp MR-4
Position: -62 Score: 6.20873 Sequence: AAATAATAATTATTCTCATTT Locus tag: Shewmr4_3318 Name: null Funciton: TonB-dependent outer membrane receptor Locus tag: Shewmr4_3319 Name: null Funciton: Periplasmic thioredoxin-family protein
Shewmr4_3318-Shewmr4_3319	-62	6.2	AAATAATAATTATTCTCATTT	Shewmr4_3318
Shewanella sp MR-7
Position: -62 Score: 6.20873 Sequence: AAATAATAATTATTCTCATTT Locus tag: Shewmr7_0635 Name: null Funciton: TonB-dependent outer membrane receptor Locus tag: Shewmr7_0634 Name: null Funciton: Periplasmic thioredoxin-family protein
Shewmr7_0635-Shewmr7_0634	-62	6.2	AAATAATAATTATTCTCATTT	Shewmr7_0635
Shewanella sp W3-18-1
Position: -62 Score: 5.63199 Sequence: AAATAATAACCATTCTCATTC Locus tag: Sputw3181_0752 Name: null Funciton: TonB-dependent outer membrane receptor Locus tag: Sputw3181_0751 Name: null Funciton: Periplasmic thioredoxin-family protein
Sputw3181_0752-Sputw3181_0751	-62	5.6	AAATAATAACCATTCTCATTC	Sputw3181_0752