Orthologous regulated operons containing SO0797 gene
| Regulog: | Fur - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Shewanella oneidensis MR-1 | ||||
|
Position: -62
Score: 6.05341 Sequence: AAATAATAACAATTCTCATTT
Locus tag: SO0798
Name: null Funciton: TonB-dependent outer membrane receptor
Locus tag: SO0797
Name: null Funciton: Periplasmic thioredoxin-family protein |
||||
| SO0798-SO0797 | -62 | 6.1 | AAATAATAACAATTCTCATTT | SO0798 |
| Shewanella putrefaciens CN-32 | ||||
|
Position: -62
Score: 5.63199 Sequence: AAATAATAACCATTCTCATTC
Locus tag: Sputcn32_3191
Name: null Funciton: TonB-dependent outer membrane receptor
Locus tag: Sputcn32_3192
Name: null Funciton: Periplasmic thioredoxin-family protein |
||||
| Sputcn32_3191-Sputcn32_3192 | -62 | 5.6 | AAATAATAACCATTCTCATTC | Sputcn32_3191 |
| Shewanella sp MR-4 | ||||
|
Position: -62
Score: 6.20873 Sequence: AAATAATAATTATTCTCATTT
Locus tag: Shewmr4_3318
Name: null Funciton: TonB-dependent outer membrane receptor
Locus tag: Shewmr4_3319
Name: null Funciton: Periplasmic thioredoxin-family protein |
||||
| Shewmr4_3318-Shewmr4_3319 | -62 | 6.2 | AAATAATAATTATTCTCATTT | Shewmr4_3318 |
| Shewanella sp MR-7 | ||||
|
Position: -62
Score: 6.20873 Sequence: AAATAATAATTATTCTCATTT
Locus tag: Shewmr7_0635
Name: null Funciton: TonB-dependent outer membrane receptor
Locus tag: Shewmr7_0634
Name: null Funciton: Periplasmic thioredoxin-family protein |
||||
| Shewmr7_0635-Shewmr7_0634 | -62 | 6.2 | AAATAATAATTATTCTCATTT | Shewmr7_0635 |
| Shewanella sp W3-18-1 | ||||
|
Position: -62
Score: 5.63199 Sequence: AAATAATAACCATTCTCATTC
Locus tag: Sputw3181_0752
Name: null Funciton: TonB-dependent outer membrane receptor
Locus tag: Sputw3181_0751
Name: null Funciton: Periplasmic thioredoxin-family protein |
||||
| Sputw3181_0752-Sputw3181_0751 | -62 | 5.6 | AAATAATAACCATTCTCATTC | Sputw3181_0752 |