Orthologous regulated operons containing SO3062 gene

Properties
Regulog:	Fur - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria

Built upon 505 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella baltica OS155
Position: -50 Score: 5.15012 Sequence: AATTGCGAATAGTTCTCAACA Locus tag: Sbal_2737 Name: null Funciton: Hypothetical inner membrane protein
Sbal_2737	-50	5.2	AATTGCGAATAGTTCTCAACA	Sbal_2737
Shewanella loihica PV-4
Position: -55 Score: 5.29184 Sequence: TGTTGAGAATCATTCTCACTA Locus tag: Shew_2300 Name: null Funciton: Hypothetical inner membrane protein
Shew_2300	-55	5.3	TGTTGAGAATCATTCTCACTA	Shew_2300
Shewanella oneidensis MR-1
Position: -67 Score: 5.48972 Sequence: TGTTGAGAACAATTCTCATCT Locus tag: SO3062 Name: null Funciton: Hypothetical inner membrane protein
SO3062	-67	5.5	TGTTGAGAACAATTCTCATCT	SO3062
Shewanella pealeana ATCC 700345
Position: -61 Score: 5.41807 Sequence: TGTTGAGAACAGTTCTCATTA Locus tag: Spea_1624 Name: null Funciton: Hypothetical inner membrane protein
Spea_1624	-61	5.4	TGTTGAGAACAGTTCTCATTA	Spea_1624
Shewanella putrefaciens CN-32
Position: -55 Score: 5.49893 Sequence: AATTGAGAACCATTCTCAACA Locus tag: Sputcn32_2436 Name: null Funciton: Hypothetical inner membrane protein
Sputcn32_2436	-55	5.5	AATTGAGAACCATTCTCAACA	Sputcn32_2436
Shewanella sp ANA-3
Position: -67 Score: 5.80037 Sequence: AGTTGAGAATAATTCTCATCT Locus tag: Shewana3_1485 Name: null Funciton: Hypothetical inner membrane protein
Shewana3_1485	-67	5.8	AGTTGAGAATAATTCTCATCT	Shewana3_1485
Shewanella sp MR-4
Position: -66 Score: 6.02558 Sequence: AATTGAGAATGATTCTCATCT Locus tag: Shewmr4_1432 Name: null Funciton: Hypothetical inner membrane protein
Shewmr4_1432	-66	6	AATTGAGAATGATTCTCATCT	Shewmr4_1432
Shewanella sp MR-7
Position: -66 Score: 5.80037 Sequence: AGTTGAGAATTATTCTCATCT Locus tag: Shewmr7_1497 Name: null Funciton: Hypothetical inner membrane protein
Shewmr7_1497	-66	5.8	AGTTGAGAATTATTCTCATCT	Shewmr7_1497
Shewanella woodyi ATCC 51908
Position: -70 Score: 6.27837 Sequence: AATTGAGAATAATTCTCATTT Locus tag: Swoo_2977 Name: null Funciton: Hypothetical inner membrane protein
Swoo_2977	-70	6.3	AATTGAGAATAATTCTCATTT	Swoo_2977

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing SO3062 gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --