Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Sden_2159 gene

Properties
Regulog: Fur - Shewanellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria
Built upon 505 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella denitrificans OS217
Position: -58
Score: 5.7843
Sequence: TATTGAGATTCATTATCATTT
Locus tag: Sden_2159
Name: null
Funciton: TonB-dependent receptor
Locus tag: Sden_2158
Name: null
Funciton: TonB mediate energy transduction system, conserved hypothetical periplasmic component
Locus tag: Sden_2157
Name: ttpc
Funciton: TonB mediated energy transduction system, inner membrane component, TtpC
Locus tag: Sden_2156
Name: exbB
Funciton: TonB mediated energy transduction system, inner membrane component, ExbB
Locus tag: Sden_2155
Name: exbD
Funciton: TonB mediated energy transduction system, membrane anchored component, ExbD
Locus tag: Sden_2154
Name: null
Funciton: TonB mediated energy transduction system, energy transducer component, TonB
Locus tag: Sden_2153
Name: tprX
Funciton: TPR repeat-containing protein
Locus tag: Sden_2152
Name: null
Funciton: Inner membrane protein with PepSY TM helix
Locus tag: Sden_2151
Name: null
Funciton: Putative exported protein
Locus tag: Sden_2150
Name: null
Funciton: putative exported protein
Sden_2159-Sden_2158-ttpc-exbB-exbD-Sden_2154-tprX-Sden_2152-Sden_2151-Sden_2150 -58 5.8 TATTGAGATTCATTATCATTT Sden_2159
© 2009-2020 RegPrecise