Orthologous regulated operons containing tprX gene
| Regulog: | Fur - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Shewanella denitrificans OS217 | ||||
|
Position: -58
Score: 5.7843 Sequence: TATTGAGATTCATTATCATTT
Locus tag: Sden_2159
Name: null Funciton: TonB-dependent receptor
Locus tag: Sden_2158
Name: null Funciton: TonB mediate energy transduction system, conserved hypothetical periplasmic component
Locus tag: Sden_2157
Name: ttpc Funciton: TonB mediated energy transduction system, inner membrane component, TtpC
Locus tag: Sden_2156
Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB
Locus tag: Sden_2155
Name: exbD Funciton: TonB mediated energy transduction system, membrane anchored component, ExbD
Locus tag: Sden_2154
Name: null Funciton: TonB mediated energy transduction system, energy transducer component, TonB
Locus tag: Sden_2153
Name: tprX Funciton: TPR repeat-containing protein
Locus tag: Sden_2152
Name: null Funciton: Inner membrane protein with PepSY TM helix
Locus tag: Sden_2151
Name: null Funciton: Putative exported protein
Locus tag: Sden_2150
Name: null Funciton: putative exported protein |
||||
| Sden_2159-Sden_2158-ttpc-exbB-exbD-Sden_2154-tprX-Sden_2152-Sden_2151-Sden_2150 | -58 | 5.8 | TATTGAGATTCATTATCATTT | Sden_2159 |
| Shewanella piezotolerans WP3 | ||||
|
Position: -84
Score: 5.74799 Sequence: GAATGAGAATCAATATCATTT
Locus tag: swp_4957
Name: null Funciton: Outer membrane receptor protein, mostly Fe transport
Locus tag: swp_4956
Name: null Funciton: Probable zinc protease
Locus tag: swp_4955
Name: null Funciton: ABC-type uncharacterized transport system, permease and ATPase components
Locus tag: swp_4954
Name: null Funciton: TonB mediate energy transduction system, conserved hypothetical periplasmic component
Locus tag: swp_4953
Name: ttpc Funciton: TonB mediated energy transduction system, inner membrane component, TtpC
Locus tag: swp_4952
Name: exbB Funciton: TonB mediated energy transduction system, inner membrane component, ExbB
Locus tag: swp_4950
Name: exbD Funciton: TonB mediated energy transduction system, membrane anchored component, ExbD
Locus tag: swp_4949
Name: null Funciton: Hypothetical protein
Locus tag: swp_4948
Name: null Funciton: TonB mediated energy transduction system, energy transducer component, TonB
Locus tag: swp_4947
Name: tprX Funciton: TPR repeat-containing protein |
||||
| swp_4957-swp_4956-swp_4955-swp_4954-ttpc-exbB-exbD-swp_4949-swp_4948-tprX | -84 | 5.7 | GAATGAGAATCAATATCATTT | swp_4957 |