Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing SO1190 gene

Properties
Regulog: Fur - Shewanellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria
Built upon 505 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -73
Score: 4.8188
Sequence: TGGTGAGAATTACTCTCAATT
Locus tag: Sama_2808
Name: null
Funciton: Inner membrane protein with PepSY TM helix
Locus tag: Sama_2809
Name: null
Funciton: Putative exported protein
Locus tag: Sama_2810
Name: null
Funciton: putative exported protein
Sama_2808-Sama_2809-Sama_2810 -73 4.8 TGGTGAGAATTACTCTCAATT Sama_2808
Shewanella baltica OS155
Position: -45
Score: 5.40576
Sequence: ATTTGATAATCGATCTCATTT
Locus tag: Sbal_3255
Name: null
Funciton: Inner membrane protein with PepSY TM helix
Locus tag: Sbal_3254
Name: null
Funciton: Putative exported protein
Locus tag: Sbal_3253
Name: null
Funciton: putative exported protein
Sbal_3255-Sbal_3254-Sbal_3253 -45 5.4 ATTTGATAATCGATCTCATTT Sbal_3255
Shewanella denitrificans OS217
Position: -58
Score: 5.7843
Sequence: TATTGAGATTCATTATCATTT
Locus tag: Sden_2159
Name: null
Funciton: TonB-dependent receptor
Locus tag: Sden_2158
Name: null
Funciton: TonB mediate energy transduction system, conserved hypothetical periplasmic component
Locus tag: Sden_2157
Name: ttpc
Funciton: TonB mediated energy transduction system, inner membrane component, TtpC
Locus tag: Sden_2156
Name: exbB
Funciton: TonB mediated energy transduction system, inner membrane component, ExbB
Locus tag: Sden_2155
Name: exbD
Funciton: TonB mediated energy transduction system, membrane anchored component, ExbD
Locus tag: Sden_2154
Name: null
Funciton: TonB mediated energy transduction system, energy transducer component, TonB
Locus tag: Sden_2153
Name: tprX
Funciton: TPR repeat-containing protein
Locus tag: Sden_2152
Name: null
Funciton: Inner membrane protein with PepSY TM helix
Locus tag: Sden_2151
Name: null
Funciton: Putative exported protein
Locus tag: Sden_2150
Name: null
Funciton: putative exported protein
Sden_2159-Sden_2158-ttpc-exbB-exbD-Sden_2154-tprX-Sden_2152-Sden_2151-Sden_2150 -58 5.8 TATTGAGATTCATTATCATTT Sden_2159
Shewanella oneidensis MR-1
Position: -185
Score: 5.43001
Sequence: TTTTGATAATAAATATCATTT
Locus tag: SO1188
Name: null
Funciton: Inner membrane protein with PepSY TM helix
Locus tag: SO1189
Name: null
Funciton: Putative exported protein
Locus tag: SO1190
Name: null
Funciton: putative exported protein
SO1188-SO1189-SO1190 -185 5.4 TTTTGATAATAAATATCATTT SO1188
Shewanella putrefaciens CN-32
Position: -93
Score: 5.17771
Sequence: GTTTGATAATAAATATCATTT
Locus tag: Sputcn32_2850
Name: null
Funciton: Inner membrane protein with PepSY TM helix
Locus tag: Sputcn32_2849
Name: null
Funciton: Putative exported protein
Locus tag: Sputcn32_2848
Name: null
Funciton: putative exported protein
Sputcn32_2850-Sputcn32_2849-Sputcn32_2848 -93 5.2 GTTTGATAATAAATATCATTT Sputcn32_2850
Shewanella sp ANA-3
Position: -181
Score: 5.56954
Sequence: TGTTGATAATAAATATCATTT
Locus tag: Shewana3_1014
Name: null
Funciton: Inner membrane protein with PepSY TM helix
Locus tag: Shewana3_1015
Name: null
Funciton: Putative exported protein
Locus tag: Shewana3_1016
Name: null
Funciton: putative exported protein
Shewana3_1014-Shewana3_1015-Shewana3_1016 -181 5.6 TGTTGATAATAAATATCATTT Shewana3_1014
Shewanella sp MR-4
Position: -181
Score: 5.56954
Sequence: TGTTGATAATAAATATCATTT
Locus tag: Shewmr4_1010
Name: null
Funciton: Inner membrane protein with PepSY TM helix
Locus tag: Shewmr4_1011
Name: null
Funciton: Putative exported protein
Locus tag: Shewmr4_1012
Name: null
Funciton: putative exported protein
Shewmr4_1010-Shewmr4_1011-Shewmr4_1012 -181 5.6 TGTTGATAATAAATATCATTT Shewmr4_1010
Shewanella sp MR-7
Position: -181
Score: 5.56954
Sequence: TGTTGATAATAAATATCATTT
Locus tag: Shewmr7_1075
Name: null
Funciton: Inner membrane protein with PepSY TM helix
Locus tag: Shewmr7_1076
Name: null
Funciton: Putative exported protein
Locus tag: Shewmr7_1077
Name: null
Funciton: putative exported protein
Shewmr7_1075-Shewmr7_1076-Shewmr7_1077 -181 5.6 TGTTGATAATAAATATCATTT Shewmr7_1075
Shewanella sp W3-18-1
Position: -93
Score: 5.17771
Sequence: GTTTGATAATAAATATCATTT
Locus tag: Sputw3181_1054
Name: null
Funciton: Inner membrane protein with PepSY TM helix
Locus tag: Sputw3181_1055
Name: null
Funciton: Putative exported protein
Locus tag: Sputw3181_1056
Name: null
Funciton: putative exported protein
Sputw3181_1054-Sputw3181_1055-Sputw3181_1056 -93 5.2 GTTTGATAATAAATATCATTT Sputw3181_1054
© 2009-2020 RegPrecise