Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing omp gene

Properties
Regulog: Fur - Shewanellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria
Built upon 505 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella frigidimarina NCIMB 400
Position: -102
Score: 4.97258
Sequence: GATTGATAATCGTTGTTATTA
Locus tag: Sfri_3225
Name: omp
Funciton: TonB-dependent siderophore receptor
Locus tag: Sfri_3224
Name: null
Funciton: Iron-regulated inner membrane protein
Locus tag: Sfri_3223
Name: null
Funciton: Iron-regulated inner membrane protein
Locus tag: Sfri_3222
Name: null
Funciton: Iron-regulated membrane protein
omp-Sfri_3224-Sfri_3223-Sfri_3222 -102 5 GATTGATAATCGTTGTTATTA Sfri_3225
© 2009-2020 RegPrecise