Orthologous regulated operons containing SO0447 gene

Properties
Regulog:	Fur - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria

Built upon 505 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella denitrificans OS217
Position: -72 Score: 5.23678 Sequence: AATTGCAAATCACTCTCATTT Locus tag: Sden_0620 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: Sden_0619 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: Sden_0618 Name: null Funciton: Iron-regulated membrane protein
Sden_0620-Sden_0619-Sden_0618	-72	5.2	AATTGCAAATCACTCTCATTT	Sden_0620
Shewanella frigidimarina NCIMB 400
Position: -102 Score: 4.97258 Sequence: GATTGATAATCGTTGTTATTA Locus tag: Sfri_3225 Name: omp Funciton: TonB-dependent siderophore receptor Locus tag: Sfri_3224 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: Sfri_3223 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: Sfri_3222 Name: null Funciton: Iron-regulated membrane protein
omp-Sfri_3224-Sfri_3223-Sfri_3222	-102	5	GATTGATAATCGTTGTTATTA	Sfri_3225
Shewanella oneidensis MR-1
Position: -146 Score: 5.21078 Sequence: TATTGCGAACTATTCTCATCA Locus tag: SO0447 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: SO0448 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: SO0449 Name: null Funciton: Iron-regulated membrane protein
SO0447-SO0448-SO0449	-146	5.2	TATTGCGAACTATTCTCATCA	SO0447
Shewanella putrefaciens CN-32
Position: -184 Score: 5.24425 Sequence: TATTGCGAATTGTTATCAATA Locus tag: Sputcn32_3397 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: Sputcn32_3396 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: Sputcn32_3395 Name: null Funciton: Iron-regulated membrane protein
Sputcn32_3397-Sputcn32_3396-Sputcn32_3395	-184	5.2	TATTGCGAATTGTTATCAATA	Sputcn32_3397
Shewanella sp ANA-3
Position: -152 Score: 5.05546 Sequence: TATTGCGAACTGTTCTCATCA Locus tag: Shewana3_0445 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: Shewana3_0446 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: Shewana3_0447 Name: null Funciton: Iron-regulated membrane protein
Shewana3_0445-Shewana3_0446-Shewana3_0447	-152	5.1	TATTGCGAACTGTTCTCATCA	Shewana3_0445
Shewanella sp MR-4
Position: -153 Score: 4.7877 Sequence: TATTGCGAACTATTCTCACCA Locus tag: Shewmr4_0449 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: Shewmr4_0450 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: Shewmr4_0451 Name: null Funciton: Iron-regulated membrane protein
Shewmr4_0449-Shewmr4_0450-Shewmr4_0451	-153	4.8	TATTGCGAACTATTCTCACCA	Shewmr4_0449
Shewanella sp MR-7
Position: -155 Score: 4.7877 Sequence: TATTGCGAACTATTCTCACCA Locus tag: Shewmr7_3580 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: Shewmr7_3579 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: Shewmr7_3578 Name: null Funciton: Iron-regulated membrane protein
Shewmr7_3580-Shewmr7_3579-Shewmr7_3578	-155	4.8	TATTGCGAACTATTCTCACCA	Shewmr7_3580
Shewanella sp W3-18-1
Position: -182 Score: 5.24425 Sequence: TATTGCGAATTGTTATCAATA Locus tag: Sputw3181_0546 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: Sputw3181_0547 Name: null Funciton: Iron-regulated inner membrane protein Locus tag: Sputw3181_0548 Name: null Funciton: Iron-regulated membrane protein
Sputw3181_0546-Sputw3181_0547-Sputw3181_0548	-182	5.2	TATTGCGAATTGTTATCAATA	Sputw3181_0546

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing SO0447 gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --