Orthologous regulated operons containing SO3667 gene

Properties
Regulog:	Fur - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria

Built upon 505 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella baltica OS155
Position: -284 Score: 6.10539 Sequence: AAATGATAATGATTTGCATTT Locus tag: Sbal_0952 Name: hmuA Funciton: TonB-dependent haem/haemoglobin receptor, HmuA Locus tag: Sbal_0953 Name: huvX Funciton: Putative heme iron utilization protein Locus tag: Sbal_0954 Name: null Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
hmuA-huvX-Sbal_0954	-284	6.1	AAATGATAATGATTTGCATTT	Sbal_0952
Shewanella denitrificans OS217
Position: -133 Score: 6.468 Sequence: AAATGATAATGATTTTCATTT Locus tag: Sden_0790 Name: hmuA Funciton: TonB-dependent haem/haemoglobin receptor, HmuA Locus tag: Sden_0791 Name: huvX Funciton: Putative heme iron utilization protein Locus tag: Sden_0792 Name: null Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
hmuA-huvX-Sden_0792	-133	6.5	AAATGATAATGATTTTCATTT	Sden_0790
Shewanella halifaxensis HAW-EB4
Position: -144 Score: 6.468 Sequence: AAATGATAATGATTTTCATTT Locus tag: Shal_3399 Name: hmuA Funciton: TonB-dependent haem/haemoglobin receptor, HmuA Locus tag: Shal_3398 Name: huvX Funciton: Putative heme iron utilization protein Locus tag: Shal_3397 Name: null Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
hmuA-huvX-Shal_3397	-144	6.5	AAATGATAATGATTTTCATTT	Shal_3399
Shewanella oneidensis MR-1
Position: -169 Score: 5.72154 Sequence: AAATGATAATGATTTCTATTT Locus tag: SO3669 Name: hmuA Funciton: TonB-dependent haem/haemoglobin receptor, HmuA Locus tag: SO3668 Name: huvX Funciton: Putative heme iron utilization protein Locus tag: SO3667 Name: null Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
hmuA-huvX-SO3667	-169	5.7	AAATGATAATGATTTCTATTT	SO3669
Shewanella pealeana ATCC 700345
Position: -143 Score: 6.468 Sequence: AAATGATAATGATTTTCATTT Locus tag: Spea_3327 Name: hmuA Funciton: TonB-dependent haem/haemoglobin receptor, HmuA Locus tag: Spea_3326 Name: huvX Funciton: Putative heme iron utilization protein Locus tag: Spea_3325 Name: null Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
hmuA-huvX-Spea_3325	-143	6.5	AAATGATAATGATTTTCATTT	Spea_3327
Shewanella putrefaciens CN-32
Position: -178 Score: 6.0511 Sequence: AAATGATAATGATTACCATTT Locus tag: Sputcn32_0966 Name: hmuA Funciton: TonB-dependent haem/haemoglobin receptor, HmuA Locus tag: Sputcn32_0967 Name: huvX Funciton: Putative heme iron utilization protein Locus tag: Sputcn32_0968 Name: null Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
hmuA-huvX-Sputcn32_0968	-178	6.1	AAATGATAATGATTACCATTT	Sputcn32_0966
Shewanella sp ANA-3
Position: -171 Score: 6.01763 Sequence: AAATGATAATGATTTCCATTT Locus tag: Shewana3_3235 Name: hmuA Funciton: TonB-dependent haem/haemoglobin receptor, HmuA Locus tag: Shewana3_3234 Name: huvX Funciton: Putative heme iron utilization protein Locus tag: Shewana3_3233 Name: null Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
hmuA-huvX-Shewana3_3233	-171	6	AAATGATAATGATTTCCATTT	Shewana3_3235
Shewanella sp W3-18-1
Position: -178 Score: 6.0511 Sequence: AAATGATAATGATTACCATTT Locus tag: Sputw3181_3201 Name: hmuA Funciton: TonB-dependent haem/haemoglobin receptor, HmuA Locus tag: Sputw3181_3200 Name: huvX Funciton: Putative heme iron utilization protein Locus tag: Sputw3181_3199 Name: null Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
hmuA-huvX-Sputw3181_3199	-178	6.1	AAATGATAATGATTACCATTT	Sputw3181_3201
Shewanella woodyi ATCC 51908
Position: -113 Score: 6.468 Sequence: AAATGATAATGATTTTCATTT Locus tag: Swoo_4004 Name: hmuA Funciton: TonB-dependent haem/haemoglobin receptor, HmuA Locus tag: Swoo_4003 Name: huvX Funciton: Putative heme iron utilization protein Locus tag: Swoo_4002 Name: null Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein
hmuA-huvX-Swoo_4002	-113	6.5	AAATGATAATGATTTTCATTT	Swoo_4004

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing SO3667 gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --