Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing omcA3 gene

Properties
Regulog: Fur - Shewanellaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria
Built upon 505 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella putrefaciens CN-32
Position: -64
Score: 5.70755
Sequence: TAATGAGATTAATTCTTATTT
Locus tag: Sputcn32_1479
Name: omcA3
Funciton: Surface localized undecaheme cytochrome c lipoprotein, UndA
omcA3 -64 5.7 TAATGAGATTAATTCTTATTT Sputcn32_1479
Shewanella sp W3-18-1
Position: -64
Score: 5.70755
Sequence: TAATGAGATTAATTCTTATTT
Locus tag: Sputw3181_2622
Name: omcA3
Funciton: Surface localized undecaheme cytochrome c lipoprotein, UndA
omcA3 -64 5.7 TAATGAGATTAATTCTTATTT Sputw3181_2622
© 2009-2020 RegPrecise