Orthologous regulated operons containing fbpC gene

Properties
Regulog:	Fur - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria

Built upon 505 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -57 Score: 5.78154 Sequence: TAGTGATAATAATTATCATTA Locus tag: Sama_0666 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA Locus tag: Sama_0667 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: Sama_0668 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
fbpA-fbpB-fbpC	-57	5.8	TAGTGATAATAATTATCATTA	Sama_0666
Shewanella frigidimarina NCIMB 400
Position: -67 Score: 5.91417 Sequence: AATTGATAACCATTATCAATT Locus tag: Sfri_0636 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA Locus tag: Sfri_0637 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: Sfri_0638 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
fbpA-fbpB-fbpC	-67	5.9	AATTGATAACCATTATCAATT	Sfri_0636
Shewanella halifaxensis HAW-EB4
Position: -64 Score: 5.38864 Sequence: AATTGAGAATTATTATCAGTC Locus tag: Shal_0897 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA Locus tag: Shal_0898 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: Shal_0899 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
fbpA-fbpB-fbpC	-64	5.4	AATTGAGAATTATTATCAGTC	Shal_0897
Shewanella loihica PV-4
Position: -41 Score: 6.14395 Sequence: AATTGATAATTATTATCATTA Locus tag: Shew_0861 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA Locus tag: Shew_0862 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: Shew_0863 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
fbpA-fbpB-fbpC	-41	6.1	AATTGATAATTATTATCATTA	Shew_0861
Shewanella oneidensis MR-1
Position: -76 Score: 5.71206 Sequence: AACTGATAACTATTATCATTA Locus tag: SO0744 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA Locus tag: SO0743 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: SO0742 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
fbpA-fbpB-fbpC	-76	5.7	AACTGATAACTATTATCATTA	SO0744
Shewanella pealeana ATCC 700345
Position: -60 Score: 5.79626 Sequence: AATTGAGAATTATTATCAGTT Locus tag: Spea_0844 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA Locus tag: Spea_0845 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: Spea_0846 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
fbpA-fbpB-fbpC	-60	5.8	AATTGAGAATTATTATCAGTT	Spea_0844
Shewanella piezotolerans WP3
Position: -60 Score: 5.24661 Sequence: AATTGAGAACTATTATCAGCA Locus tag: swp_4107 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA Locus tag: swp_4106 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: swp_4105 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
fbpA-fbpB-fbpC	-60	5.2	AATTGAGAACTATTATCAGCA	swp_4107
Shewanella putrefaciens CN-32
Position: -74 Score: 5.78154 Sequence: AAGTGATAACTATTATCATTA Locus tag: Sputcn32_3227 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA Locus tag: Sputcn32_3226 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: Sputcn32_3225 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
fbpA-fbpB-fbpC	-74	5.8	AAGTGATAACTATTATCATTA	Sputcn32_3227
Shewanella sediminis HAW-EB3
Position: -154 Score: 5.27608 Sequence: GAATTATAATCATTCTTATTT Locus tag: Ssed_0946 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: Ssed_0947 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
fbpB-fbpC	-154	5.3	GAATTATAATCATTCTTATTT	Ssed_0946
Shewanella sp ANA-3
Position: -76 Score: 5.71206 Sequence: AACTGATAACTATTATCATTA Locus tag: Shewana3_3517 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA Locus tag: Shewana3_3516 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: Shewana3_3515 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
fbpA-fbpB-fbpC	-76	5.7	AACTGATAACTATTATCATTA	Shewana3_3517
Shewanella sp MR-4
Position: -76 Score: 5.71206 Sequence: AACTGATAACTATTATCATTA Locus tag: Shewmr4_3347 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA Locus tag: Shewmr4_3346 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: Shewmr4_3345 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
fbpA-fbpB-fbpC	-76	5.7	AACTGATAACTATTATCATTA	Shewmr4_3347
Shewanella sp MR-7
Position: -76 Score: 5.71206 Sequence: AACTGATAACTATTATCATTA Locus tag: Shewmr7_0606 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA Locus tag: Shewmr7_0607 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: Shewmr7_0608 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
fbpA-fbpB-fbpC	-76	5.7	AACTGATAACTATTATCATTA	Shewmr7_0606
Shewanella sp W3-18-1
Position: -74 Score: 5.78154 Sequence: AAGTGATAACTATTATCATTA Locus tag: Sputw3181_0714 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA Locus tag: Sputw3181_0715 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: Sputw3181_0716 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
fbpA-fbpB-fbpC	-74	5.8	AAGTGATAACTATTATCATTA	Sputw3181_0714
Shewanella woodyi ATCC 51908
Position: -79 Score: 5.50451 Sequence: AATTAATAATCGTTTTTATTT Locus tag: Swoo_0997 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: Swoo_0998 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
fbpB-fbpC	-79	5.5	AATTAATAATCGTTTTTATTT	Swoo_0997

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing fbpC gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --