Orthologous regulated operons containing ftn gene

Properties
Regulog:	Fur - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria

Built upon 505 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -113 Score: 5.05053 Sequence: TAATGATAAGTGTTACTATTT Locus tag: Sama_0141 Name: ftn Funciton: Ferritin, Ftn
ftn	-113	5.1	TAATGATAAGTGTTACTATTT	Sama_0141
Shewanella baltica OS155
Position: -131 Score: 5.74412 Sequence: AAATGAAAATCATTTTTATCA Locus tag: Sbal_4222 Name: ftn Funciton: Ferritin, Ftn
ftn	-131	5.7	AAATGAAAATCATTTTTATCA	Sbal_4222
Shewanella halifaxensis HAW-EB4
Position: -111 Score: 6.01659 Sequence: AAATGAAAACCATTATTATTT Locus tag: Shal_4189 Name: ftn Funciton: Ferritin, Ftn
ftn	-111	6	AAATGAAAACCATTATTATTT	Shal_4189
Shewanella loihica PV-4
Position: -381 Score: 5.42415 Sequence: TAACGATAATTATTTGCATTT Locus tag: Shew_0042 Name: ftn Funciton: Ferritin, Ftn
ftn	-381	5.4	TAACGATAATTATTTGCATTT	Shew_0042
Shewanella oneidensis MR-1
Position: -133 Score: 5.74412 Sequence: AAATGAAAATCATTTTTATCA Locus tag: SO0139 Name: ftn Funciton: Ferritin, Ftn
ftn	-133	5.7	AAATGAAAATCATTTTTATCA	SO0139
Shewanella pealeana ATCC 700345
Position: -111 Score: 6.01659 Sequence: AAATGAAAACCATTATTATTT Locus tag: Spea_0129 Name: ftn Funciton: Ferritin, Ftn
ftn	-111	6	AAATGAAAACCATTATTATTT	Spea_0129
Shewanella piezotolerans WP3
Position: -110 Score: 6.01659 Sequence: AAATGAAAACCATTATTATTT Locus tag: swp_0167 Name: ftn Funciton: Ferritin, Ftn
ftn	-110	6	AAATGAAAACCATTATTATTT	swp_0167
Shewanella putrefaciens CN-32
Position: -131 Score: 5.74412 Sequence: AAATGAAAATCATTTTTATCA Locus tag: Sputcn32_0132 Name: ftn Funciton: Ferritin, Ftn
ftn	-131	5.7	AAATGAAAATCATTTTTATCA	Sputcn32_0132
Shewanella sediminis HAW-EB3
Position: -107 Score: 5.70124 Sequence: TAATGATAATTATTAGTATTT Locus tag: Ssed_4374 Name: ftn Funciton: Ferritin, Ftn
ftn	-107	5.7	TAATGATAATTATTAGTATTT	Ssed_4374
Shewanella sp ANA-3
Position: -132 Score: 5.74412 Sequence: AAATGAAAATCATTTTTATCA Locus tag: Shewana3_0132 Name: ftn Funciton: Ferritin, Ftn
ftn	-132	5.7	AAATGAAAATCATTTTTATCA	Shewana3_0132
Shewanella sp MR-4
Position: -132 Score: 5.3815 Sequence: AAATGCAAATCATTTTTATCA Locus tag: Shewmr4_0133 Name: ftn Funciton: Ferritin, Ftn
ftn	-132	5.4	AAATGCAAATCATTTTTATCA	Shewmr4_0133
Shewanella sp MR-7
Position: -132 Score: 5.3815 Sequence: AAATGCAAATCATTTTTATCA Locus tag: Shewmr7_0127 Name: ftn Funciton: Ferritin, Ftn
ftn	-132	5.4	AAATGCAAATCATTTTTATCA	Shewmr7_0127
Shewanella sp W3-18-1
Position: -131 Score: 5.74412 Sequence: AAATGAAAATCATTTTTATCA Locus tag: Sputw3181_3940 Name: ftn Funciton: Ferritin, Ftn
ftn	-131	5.7	AAATGAAAATCATTTTTATCA	Sputw3181_3940
Shewanella woodyi ATCC 51908
Position: -176 Score: 5.65732 Sequence: TAATGAGAATTATTTGTATTT Locus tag: Swoo_4766 Name: ftn Funciton: Ferritin, Ftn
ftn	-176	5.7	TAATGAGAATTATTTGTATTT	Swoo_4766

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing ftn gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --