Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Swoo_2222 gene

Properties
Regulog: Crp - Shewanellaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria
Built upon 2713 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella woodyi ATCC 51908
Position: -140
Score: 4.05319
Sequence: ATTTTTGATGCTAATCAAATGA
Locus tag: Swoo_2219
Name: resA
Funciton: C-type cytochrome biogenesis protein ResA (thioredoxin)
Locus tag: Swoo_2220
Name: SO2101
Funciton: lipoprotein, putative
Locus tag: Swoo_2221
Name: null
Funciton: hypothetical protein
Locus tag: Swoo_2222
Name: null
Funciton: transposase and inactivated derivative
resA-SO2101-Swoo_2221-Swoo_2222 -140 4.1 ATTTTTGATGCTAATCAAATGA Swoo_2219