Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Shewana3_1142 gene

Properties
Regulog: Crp - Shewanellaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria
Built upon 2713 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella baltica OS155
Position: -78
Score: 5.50059
Sequence: AAATGTGATTAAGTTCACAATT
Locus tag: Sbal_1230
Name: null
Funciton: hypothetical protein
Locus tag: Sbal_1231
Name: SO3412
Funciton: extracellular solute-binding proteins, family 3 protein
Locus tag: Sbal_1232
Name: SO3411
Funciton: tricorn protease homolog (EC 3.4.21.-)
Sbal_1230-SO3412-SO3411 -78 5.5 AAATGTGATTAAGTTCACAATT Sbal_1230
Shewanella halifaxensis HAW-EB4
Position: -77
Score: 3.80397
Sequence: CGGTGCGATCTGTATCACTATT
Locus tag: Shal_1117
Name: null
Funciton: hypothetical protein
Shal_1117 -77 3.8 CGGTGCGATCTGTATCACTATT Shal_1117
Shewanella pealeana ATCC 700345
Position: -77
Score: 4.38742
Sequence: CTGTGCGATCTGTGTCACAATT
Locus tag: Spea_1069
Name: null
Funciton: hypothetical protein
Spea_1069 -77 4.4 CTGTGCGATCTGTGTCACAATT Spea_1069
Shewanella sp ANA-3
Position: -85
Score: 4.3711
Sequence: GGATGTGAGTTGCTTCACAATT
Locus tag: Shewana3_1142
Name: null
Funciton: hypothetical protein
Locus tag: Shewana3_1143
Name: SO3412
Funciton: extracellular solute-binding proteins, family 3 protein
Locus tag: Shewana3_1144
Name: SO3411
Funciton: tricorn protease homolog (EC 3.4.21.-)
Shewana3_1142-SO3412-SO3411 -85 4.4 GGATGTGAGTTGCTTCACAATT Shewana3_1142
Shewanella sp MR-4
Position: -85
Score: 5.01795
Sequence: AGATGTGACTTGCCTCACAATT
Locus tag: Shewmr4_1141
Name: null
Funciton: hypothetical protein
Locus tag: Shewmr4_1142
Name: SO3412
Funciton: extracellular solute-binding proteins, family 3 protein
Locus tag: Shewmr4_1143
Name: SO3411
Funciton: tricorn protease homolog (EC 3.4.21.-)
Shewmr4_1141-SO3412-SO3411 -85 5 AGATGTGACTTGCCTCACAATT Shewmr4_1141
Shewanella sp MR-7
Position: -85
Score: 4.42071
Sequence: GGATGTGACTTGCCTCACAATT
Locus tag: Shewmr7_1212
Name: null
Funciton: hypothetical protein
Locus tag: Shewmr7_1213
Name: SO3412
Funciton: extracellular solute-binding proteins, family 3 protein
Locus tag: Shewmr7_1214
Name: SO3411
Funciton: tricorn protease homolog (EC 3.4.21.-)
Shewmr7_1212-SO3412-SO3411 -85 4.4 GGATGTGACTTGCCTCACAATT Shewmr7_1212