Orthologous regulated operons containing SO3411 gene

Properties
Regulog:	Crp - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria

Built upon 2713 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella baltica OS155
Position: -78 Score: 5.50059 Sequence: AAATGTGATTAAGTTCACAATT Locus tag: Sbal_1230 Name: null Funciton: hypothetical protein Locus tag: Sbal_1231 Name: SO3412 Funciton: extracellular solute-binding proteins, family 3 protein Locus tag: Sbal_1232 Name: SO3411 Funciton: tricorn protease homolog (EC 3.4.21.-)
Sbal_1230-SO3412-SO3411	-78	5.5	AAATGTGATTAAGTTCACAATT	Sbal_1230
Shewanella sediminis HAW-EB3
Position: -101 Score: 3.97648 Sequence: TATTGTGAAATATTTTACTGTT Locus tag: Ssed_1339 Name: SO3411 Funciton: tricorn protease homolog (EC 3.4.21.-)
SO3411	-101	4	TATTGTGAAATATTTTACTGTT	Ssed_1339
Shewanella sp ANA-3
Position: -85 Score: 4.3711 Sequence: GGATGTGAGTTGCTTCACAATT Locus tag: Shewana3_1142 Name: null Funciton: hypothetical protein Locus tag: Shewana3_1143 Name: SO3412 Funciton: extracellular solute-binding proteins, family 3 protein Locus tag: Shewana3_1144 Name: SO3411 Funciton: tricorn protease homolog (EC 3.4.21.-)
Shewana3_1142-SO3412-SO3411	-85	4.4	GGATGTGAGTTGCTTCACAATT	Shewana3_1142
Shewanella sp MR-4
Position: -85 Score: 5.01795 Sequence: AGATGTGACTTGCCTCACAATT Locus tag: Shewmr4_1141 Name: null Funciton: hypothetical protein Locus tag: Shewmr4_1142 Name: SO3412 Funciton: extracellular solute-binding proteins, family 3 protein Locus tag: Shewmr4_1143 Name: SO3411 Funciton: tricorn protease homolog (EC 3.4.21.-)
Shewmr4_1141-SO3412-SO3411	-85	5	AGATGTGACTTGCCTCACAATT	Shewmr4_1141
Shewanella sp MR-7
Position: -85 Score: 4.42071 Sequence: GGATGTGACTTGCCTCACAATT Locus tag: Shewmr7_1212 Name: null Funciton: hypothetical protein Locus tag: Shewmr7_1213 Name: SO3412 Funciton: extracellular solute-binding proteins, family 3 protein Locus tag: Shewmr7_1214 Name: SO3411 Funciton: tricorn protease homolog (EC 3.4.21.-)
Shewmr7_1212-SO3412-SO3411	-85	4.4	GGATGTGACTTGCCTCACAATT	Shewmr7_1212