Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing SO3551 gene

Properties
Regulog: Crp - Shewanellaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria
Built upon 2713 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -192
Score: 4.19458
Sequence: ATGTGTGAGCTTTGGCAAATTT
Locus tag: Sama_1068
Name: null
Funciton: RNA polymerase sigma-70 factor, ECF subfamily
Locus tag: Sama_1069
Name: null
Funciton: hypothetical protein
Locus tag: Sama_1070
Name: SO3412
Funciton: extracellular solute-binding proteins, family 3 protein
Sama_1068-Sama_1069-SO3412 -192 4.2 ATGTGTGAGCTTTGGCAAATTT Sama_1068