Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Shewmr4_2871 gene

Properties
Regulog: Crp - Shewanellaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria
Built upon 2713 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella sp MR-4
Position: -55
Score: 4.30048
Sequence: AATAGTGATTTTTATTGCAAAT
Locus tag: Shewmr4_2871
Name: Shewmr4_2871
Funciton: hypothetical protein
Locus tag: Shewmr4_2870
Name: SO1326
Funciton: COG1242: Predicted Fe-S oxidoreductase
Shewmr4_2871-SO1326 -55 4.3 AATAGTGATTTTTATTGCAAAT Shewmr4_2871
Shewanella sp MR-7
Position: -55
Score: 4.30048
Sequence: AATAGTGATTTTTATTGCAAAT
Locus tag: Shewmr7_2953
Name: Shewmr4_2871
Funciton: hypothetical protein
Locus tag: Shewmr7_2952
Name: SO1326
Funciton: COG1242: Predicted Fe-S oxidoreductase
Shewmr4_2871-SO1326 -55 4.3 AATAGTGATTTTTATTGCAAAT Shewmr7_2953
© 2009-2020 RegPrecise