Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Sden_0341 gene

Properties
Regulog: Crp - Shewanellaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria
Built upon 2713 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella halifaxensis HAW-EB4
Position: -114
Score: 3.76605
Sequence: TTTTGTGCTGTTTTTTATAAAG
Locus tag: Shal_0442
Name: SO4232
Funciton: long-chain fatty acid transport protein
Locus tag: Shal_0443
Name: Sden_0341
Funciton: hypothetical protein
Locus tag: Shal_0444
Name: glpK
Funciton: glycerol kinase (EC 2.7.1.30)
SO4232-Sden_0341-glpK -114 3.8 TTTTGTGCTGTTTTTTATAAAG Shal_0442