Orthologous regulated operons containing xapR gene
| Regulog: | XapR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LysR |
| Regulation mode: | activator |
| Biological process: | Xanthosine utilization |
| Effector: | Deoxyinosine; Xanthosine |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||||
|
Position: -120
Score: 6.23346 Sequence: TCAATATACATTTTATATCGA
Locus tag: CKO_00389
Name: xapA Funciton: Xanthosine phosphorylase (EC 2.4.2.1)
Locus tag: CKO_00390
Name: xapB Funciton: Xanthosine permease
Locus tag: CKO_00391
Name: xapR Funciton: Xanthosine operon regulatory protein XapR, LysR family |
||||
| xapA-xapB-xapR | -120 | 6.2 | TCAATATACATTTTATATCGA | CKO_00389 |
| Edwardsiella tarda EIB202 | ||||
|
Position: -115
Score: 4.36517 Sequence: TCCCTAGCAAATCAATACTGA
Locus tag: ETAE_2779
Name: xapA Funciton: Xanthosine phosphorylase (EC 2.4.2.1)
Locus tag: ETAE_2780
Name: xapX Funciton: Predicted xanthosine transporter
Locus tag: ETAE_2781
Name: xapR Funciton: Xanthosine operon regulatory protein XapR, LysR family |
||||
| xapA-xapX-xapR | -115 | 4.4 | TCCCTAGCAAATCAATACTGA | ETAE_2779 |
| Enterobacter sp. 638 | ||||
|
Position: -121
Score: 5.16572 Sequence: TTGATACTGAAAGAGTATTGA
Locus tag: Ent638_2934
Name: xapA Funciton: Xanthosine phosphorylase (EC 2.4.2.1)
Locus tag: Ent638_2933
Name: xapB Funciton: Xanthosine permease
Locus tag: Ent638_2932
Name: xapR Funciton: Xanthosine operon regulatory protein XapR, LysR family |
||||
| xapA-xapB-xapR | -121 | 5.2 | TTGATACTGAAAGAGTATTGA | Ent638_2934 |