Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing SO2854 gene

Properties
Regulog: Crp - Shewanellaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria
Built upon 2713 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella baltica OS155
Position: -75
Score: 4.21636
Sequence: AGTCGTGATTGTGCTCACACCA
Locus tag: Sbal_2639
Name: SO2858
Funciton: hypothetical protein
Locus tag: Sbal_2638
Name: SO2857
Funciton: sodium solute symporter family protein
Locus tag: Sbal_2637
Name: SO2856
Funciton: predicted signal-transduction protein containing cAMP-binding and CBS domains
Locus tag: Sbal_2636
Name: SO2855
Funciton: DNA polymerase III epsilon subunit (EC 2.7.7.7)
Locus tag: Sbal_2635
Name: null
Funciton: hypothetical protein
SO2858-SO2857-SO2856-SO2855-Sbal_2635 -75 4.2 AGTCGTGATTGTGCTCACACCA Sbal_2639
Shewanella oneidensis MR-1
Position: -105
Score: 4.82761
Sequence: TATTGTGAGTAAGTTCGCAAAT
Locus tag: SO2858
Name: SO2858
Funciton: hypothetical protein
Locus tag: SO2857
Name: SO2857
Funciton: sodium solute symporter family protein
Locus tag: SO2856
Name: SO2856
Funciton: predicted signal-transduction protein containing cAMP-binding and CBS domains
Locus tag: SO2855
Name: SO2855
Funciton: DNA polymerase III epsilon subunit (EC 2.7.7.7)
Locus tag: SO2854
Name: null
Funciton: hypothetical protein
SO2858-SO2857-SO2856-SO2855-SO2854 -105 4.8 TATTGTGAGTAAGTTCGCAAAT SO2858