Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing SO2857 gene

Properties
Regulog: Crp - Shewanellaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria
Built upon 2713 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella baltica OS155
Position: -75
Score: 4.21636
Sequence: AGTCGTGATTGTGCTCACACCA
Locus tag: Sbal_2639
Name: SO2858
Funciton: hypothetical protein
Locus tag: Sbal_2638
Name: SO2857
Funciton: sodium solute symporter family protein
Locus tag: Sbal_2637
Name: SO2856
Funciton: predicted signal-transduction protein containing cAMP-binding and CBS domains
Locus tag: Sbal_2636
Name: SO2855
Funciton: DNA polymerase III epsilon subunit (EC 2.7.7.7)
Locus tag: Sbal_2635
Name: null
Funciton: hypothetical protein
SO2858-SO2857-SO2856-SO2855-Sbal_2635 -75 4.2 AGTCGTGATTGTGCTCACACCA Sbal_2639
Shewanella frigidimarina NCIMB 400
Position: -237
Score: 4.94252
Sequence: TTTTGTGATGCAGATCTCAATC
Locus tag: Sfri_1546
Name: SO2858
Funciton: hypothetical protein
Locus tag: Sfri_1547
Name: SO2857
Funciton: sodium solute symporter family protein
Locus tag: Sfri_1548
Name: SO2856
Funciton: predicted signal-transduction protein containing cAMP-binding and CBS domains
Locus tag: Sfri_1549
Name: SO2855
Funciton: DNA polymerase III epsilon subunit (EC 2.7.7.7)
SO2858-SO2857-SO2856-SO2855 -237 4.9 TTTTGTGATGCAGATCTCAATC Sfri_1546
Shewanella oneidensis MR-1
Position: -105
Score: 4.82761
Sequence: TATTGTGAGTAAGTTCGCAAAT
Locus tag: SO2858
Name: SO2858
Funciton: hypothetical protein
Locus tag: SO2857
Name: SO2857
Funciton: sodium solute symporter family protein
Locus tag: SO2856
Name: SO2856
Funciton: predicted signal-transduction protein containing cAMP-binding and CBS domains
Locus tag: SO2855
Name: SO2855
Funciton: DNA polymerase III epsilon subunit (EC 2.7.7.7)
Locus tag: SO2854
Name: null
Funciton: hypothetical protein
SO2858-SO2857-SO2856-SO2855-SO2854 -105 4.8 TATTGTGAGTAAGTTCGCAAAT SO2858
Shewanella putrefaciens CN-32
Position: -75
Score: 4.21636
Sequence: AGTCGTGATTGTGCTCACACCA
Locus tag: Sputcn32_2359
Name: SO2858
Funciton: hypothetical protein
Locus tag: Sputcn32_2358
Name: SO2857
Funciton: sodium solute symporter family protein
Locus tag: Sputcn32_2357
Name: SO2856
Funciton: predicted signal-transduction protein containing cAMP-binding and CBS domains
Locus tag: Sputcn32_2356
Name: SO2855
Funciton: DNA polymerase III epsilon subunit (EC 2.7.7.7)
SO2858-SO2857-SO2856-SO2855 -75 4.2 AGTCGTGATTGTGCTCACACCA Sputcn32_2359
Shewanella sp ANA-3
Position: -105
Score: 4.03554
Sequence: GGATGTGAGCCGCTTCGCAAAT
Locus tag: Shewana3_1574
Name: SO2858
Funciton: hypothetical protein
Locus tag: Shewana3_1575
Name: SO2857
Funciton: sodium solute symporter family protein
Locus tag: Shewana3_1576
Name: SO2856
Funciton: predicted signal-transduction protein containing cAMP-binding and CBS domains
Locus tag: Shewana3_1577
Name: SO2855
Funciton: DNA polymerase III epsilon subunit (EC 2.7.7.7)
SO2858-SO2857-SO2856-SO2855 -105 4 GGATGTGAGCCGCTTCGCAAAT Shewana3_1574
Shewanella sp MR-4
Position: -105
Score: 3.93606
Sequence: CCGTGTGAGGTATTTCGCAAAT
Locus tag: Shewmr4_1513
Name: SO2858
Funciton: hypothetical protein
Locus tag: Shewmr4_1514
Name: SO2857
Funciton: sodium solute symporter family protein
Locus tag: Shewmr4_1515
Name: SO2856
Funciton: predicted signal-transduction protein containing cAMP-binding and CBS domains
Locus tag: Shewmr4_1516
Name: SO2855
Funciton: DNA polymerase III epsilon subunit (EC 2.7.7.7)
SO2858-SO2857-SO2856-SO2855 -105 3.9 CCGTGTGAGGTATTTCGCAAAT Shewmr4_1513
Shewanella sp MR-7
Position: -105
Score: 3.93606
Sequence: CCGTGTGAGGTATTTCGCAAAT
Locus tag: Shewmr7_1580
Name: SO2858
Funciton: hypothetical protein
Locus tag: Shewmr7_1581
Name: SO2857
Funciton: sodium solute symporter family protein
Locus tag: Shewmr7_1582
Name: SO2856
Funciton: predicted signal-transduction protein containing cAMP-binding and CBS domains
Locus tag: Shewmr7_1583
Name: SO2855
Funciton: DNA polymerase III epsilon subunit (EC 2.7.7.7)
SO2858-SO2857-SO2856-SO2855 -105 3.9 CCGTGTGAGGTATTTCGCAAAT Shewmr7_1580
Shewanella sp W3-18-1
Position: -75
Score: 4.21636
Sequence: AGTCGTGATTGTGCTCACACCA
Locus tag: Sputw3181_1650
Name: SO2858
Funciton: hypothetical protein
Locus tag: Sputw3181_1651
Name: SO2857
Funciton: sodium solute symporter family protein
Locus tag: Sputw3181_1652
Name: SO2856
Funciton: predicted signal-transduction protein containing cAMP-binding and CBS domains
Locus tag: Sputw3181_1653
Name: SO2855
Funciton: DNA polymerase III epsilon subunit (EC 2.7.7.7)
SO2858-SO2857-SO2856-SO2855 -75 4.2 AGTCGTGATTGTGCTCACACCA Sputw3181_1650