Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing swp_3812 gene

Properties
Regulog: Crp - Shewanellaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria
Built upon 2713 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella piezotolerans WP3
Position: -141
Score: 4.72435
Sequence: TTCTGTGATTCAGGTCGCAAAT
Locus tag: swp_3809
Name: Sbal_1323
Funciton: HTH-type transcriptional regulator BetI
Locus tag: swp_3810
Name: Sbal_1324
Funciton: betaine aldehyde dehydrogenase (EC 1.2.1.8)
Locus tag: swp_3811
Name: Sbal_1325
Funciton: choline dehydrogenase (EC 1.1.99.1)
Locus tag: swp_3812
Name: null
Funciton: hypothetical protein swp_3812
Locus tag: swp_3813
Name: Sden_0716
Funciton: predicted choline transporter BetT-II
Locus tag: swp_3814
Name: Sbal_1327
Funciton: conserved hypothetical protein 2001
Locus tag: swp_3815
Name: marR
Funciton: transcriptional regulator, MarR family
Sbal_1323-Sbal_1324-Sbal_1325-swp_3812-Sden_0716-Sbal_1327-marR -141 4.7 TTCTGTGATTCAGGTCGCAAAT swp_3809