Orthologous regulated operons containing prmA gene

Properties
Regulog:	Crp - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria

Built upon 2713 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella halifaxensis HAW-EB4
Position: -281 Score: 3.93409 Sequence: TTTCGTGATCAGTGTCACTACA Position: -249 Score: 3.71459 Sequence: CTATTAGACGTAGATCACAAAC Locus tag: Shal_3900 Name: prmA Funciton: ribosomal protein L11 methyltransferase (EC 2.1.1.-) Locus tag: Shal_3901 Name: nifR3 Funciton: tRNA dihydrouridine synthase B (EC 1.-.-.-) Locus tag: Shal_3902 Name: fis Funciton: DNA-binding protein Fis
prmA- nifR3-fis	-281	3.9	TTTCGTGATCAGTGTCACTACA	Shal_3900
	-249	3.7	CTATTAGACGTAGATCACAAAC
Shewanella loihica PV-4
Position: -274 Score: 3.82674 Sequence: AAGCGTGAGACACCTCACCCTG Position: -242 Score: 4.1446 Sequence: ACATTTGACGTCGATCACAAAC Locus tag: Shew_0331 Name: prmA Funciton: ribosomal protein L11 methyltransferase (EC 2.1.1.-) Locus tag: Shew_0330 Name: nifR3 Funciton: tRNA dihydrouridine synthase B (EC 1.-.-.-) Locus tag: Shew_0329 Name: fis Funciton: DNA-binding protein Fis
prmA- nifR3-fis	-274	3.8	AAGCGTGAGACACCTCACCCTG	Shew_0331
	-242	4.1	ACATTTGACGTCGATCACAAAC
Shewanella pealeana ATCC 700345
Position: -283 Score: 4.27846 Sequence: TTTCGTGAAGGAACTCACCCTT Position: -251 Score: 4.13131 Sequence: CTATTAGATCAAGATCACAAAT Locus tag: Spea_0391 Name: prmA Funciton: ribosomal protein L11 methyltransferase (EC 2.1.1.-) Locus tag: Spea_0390 Name: nifR3 Funciton: tRNA dihydrouridine synthase B (EC 1.-.-.-) Locus tag: Spea_0389 Name: fis Funciton: DNA-binding protein Fis
prmA- nifR3-fis	-283	4.3	TTTCGTGAAGGAACTCACCCTT	Spea_0391
	-251	4.1	CTATTAGATCAAGATCACAAAT
Shewanella piezotolerans WP3
Position: -286 Score: 4.52099 Sequence: AATCGTGACTTTGCTCACCCTA Locus tag: swp_0427 Name: prmA Funciton: ribosomal protein L11 methyltransferase (EC 2.1.1.-) Locus tag: swp_0426 Name: nifR3 Funciton: tRNA dihydrouridine synthase B (EC 1.-.-.-) Locus tag: swp_0425 Name: fis Funciton: DNA-binding protein Fis
prmA- nifR3-fis	-286	4.5	AATCGTGACTTTGCTCACCCTA	swp_0427
Shewanella sediminis HAW-EB3
Position: -53 Score: 4.96993 Sequence: TAATGTGATTGGTATTACAATA Locus tag: Ssed_4117 Name: prmA Funciton: ribosomal protein L11 methyltransferase (EC 2.1.1.-) Locus tag: Ssed_4118 Name: nifR3 Funciton: tRNA dihydrouridine synthase B (EC 1.-.-.-) Locus tag: Ssed_4119 Name: fis Funciton: DNA-binding protein Fis
prmA- nifR3-fis	-53	5	TAATGTGATTGGTATTACAATA	Ssed_4117
Shewanella woodyi ATCC 51908
Position: -233 Score: 4.48598 Sequence: TTTTTTGAACCACATCACAAAC Locus tag: Swoo_0506 Name: prmA Funciton: ribosomal protein L11 methyltransferase (EC 2.1.1.-) Locus tag: Swoo_0505 Name: nifR3 Funciton: tRNA dihydrouridine synthase B (EC 1.-.-.-) Locus tag: Swoo_0504 Name: fis Funciton: DNA-binding protein Fis
prmA- nifR3-fis	-233	4.5	TTTTTTGAACCACATCACAAAC	Swoo_0506

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing prmA gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --