Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing purE gene

Properties
Regulog: Crp - Shewanellaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria
Built upon 2713 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella halifaxensis HAW-EB4
Position: -269
Score: 4.35424
Sequence: TTGTGGGATCTAGGTAACATTT
Locus tag: Shal_1245
Name: null
Funciton: phosphoribosylaminoimidazole carboxylase, catalytic subunit
Locus tag: Shal_1246
Name: SO3551
Funciton: RNA polymerase sigma-70 factor, ECF subfamily
Locus tag: Shal_1247
Name: null
Funciton: hypothetical protein
Shal_1245-SO3551-Shal_1247 -269 4.4 TTGTGGGATCTAGGTAACATTT Shal_1245