Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing znuA gene

Properties
Regulog: Crp - Shewanellaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria
Built upon 2713 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -38
Score: 4.51135
Sequence: AAACTTGAGCCGCTTCACAAAT
Locus tag: Sama_3143
Name: Spea_3717
Funciton: hypothetical protein
Locus tag: Sama_3142
Name: omp_Zn
Funciton: zinc-regulated TonB-dependent outer membrane receptor
Locus tag: Sama_3141
Name: znuA
Funciton: zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Sama_3140
Name: znuB
Funciton: zinc ABC transporter, inner membrane permease protein ZnuB
Spea_3717-omp_Zn-znuA-znuB -38 4.5 AAACTTGAGCCGCTTCACAAAT Sama_3143
Shewanella halifaxensis HAW-EB4
Position: -117
Score: 4.67336
Sequence: TTAGGTGATCTGCCTCACAAAG
Locus tag: Shal_3802
Name: Spea_3717
Funciton: hypothetical protein
Locus tag: Shal_3801
Name: omp_Zn
Funciton: zinc-regulated TonB-dependent outer membrane receptor
Locus tag: Shal_3800
Name: znuA
Funciton: zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Shal_3799
Name: znuB
Funciton: zinc ABC transporter, inner membrane permease protein ZnuB
Spea_3717-omp_Zn-znuA-znuB -117 4.7 TTAGGTGATCTGCCTCACAAAG Shal_3802
Shewanella pealeana ATCC 700345
Position: -117
Score: 4.68675
Sequence: TTAGGTGATCTGCTTCACAAAC
Locus tag: Spea_3717
Name: Spea_3717
Funciton: hypothetical protein
Locus tag: Spea_3716
Name: omp_Zn
Funciton: zinc-regulated TonB-dependent outer membrane receptor
Locus tag: Spea_3715
Name: znuA
Funciton: zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Spea_3714
Name: znuB
Funciton: zinc ABC transporter, inner membrane permease protein ZnuB
Spea_3717-omp_Zn-znuA-znuB -117 4.7 TTAGGTGATCTGCTTCACAAAC Spea_3717