Orthologous regulated operons containing Spea_3717 gene

Properties
Regulog:	Crp - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria

Built upon 2713 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -38 Score: 4.51135 Sequence: AAACTTGAGCCGCTTCACAAAT Locus tag: Sama_3143 Name: Spea_3717 Funciton: hypothetical protein Locus tag: Sama_3142 Name: omp_Zn Funciton: zinc-regulated TonB-dependent outer membrane receptor Locus tag: Sama_3141 Name: znuA Funciton: zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Sama_3140 Name: znuB Funciton: zinc ABC transporter, inner membrane permease protein ZnuB
Spea_3717-omp_Zn-znuA-znuB	-38	4.5	AAACTTGAGCCGCTTCACAAAT	Sama_3143
Shewanella halifaxensis HAW-EB4
Position: -117 Score: 4.67336 Sequence: TTAGGTGATCTGCCTCACAAAG Locus tag: Shal_3802 Name: Spea_3717 Funciton: hypothetical protein Locus tag: Shal_3801 Name: omp_Zn Funciton: zinc-regulated TonB-dependent outer membrane receptor Locus tag: Shal_3800 Name: znuA Funciton: zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Shal_3799 Name: znuB Funciton: zinc ABC transporter, inner membrane permease protein ZnuB
Spea_3717-omp_Zn-znuA-znuB	-117	4.7	TTAGGTGATCTGCCTCACAAAG	Shal_3802
Shewanella pealeana ATCC 700345
Position: -117 Score: 4.68675 Sequence: TTAGGTGATCTGCTTCACAAAC Locus tag: Spea_3717 Name: Spea_3717 Funciton: hypothetical protein Locus tag: Spea_3716 Name: omp_Zn Funciton: zinc-regulated TonB-dependent outer membrane receptor Locus tag: Spea_3715 Name: znuA Funciton: zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Spea_3714 Name: znuB Funciton: zinc ABC transporter, inner membrane permease protein ZnuB
Spea_3717-omp_Zn-znuA-znuB	-117	4.7	TTAGGTGATCTGCTTCACAAAC	Spea_3717