Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing shew_3182 gene

Properties
Regulog: Crp - Shewanellaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria
Built upon 2713 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella frigidimarina NCIMB 400
Position: -198
Score: 3.96967
Sequence: ATATGTCATACATTTAACGTAT
Locus tag: Sfri_3694
Name: shew_3181
Funciton: twin-arginine translocation pathway signal precursor
Locus tag: Sfri_3693
Name: shew_3182
Funciton: tetraheme cytochrome c
shew_3181-shew_3182 -198 4 ATATGTCATACATTTAACGTAT Sfri_3694
Shewanella loihica PV-4
Position: -207
Score: 4.26939
Sequence: TTTTGTGAAGCACAGCAAAGAT
Locus tag: Shew_3181
Name: shew_3181
Funciton: twin-arginine translocation pathway signal precursor
Locus tag: Shew_3182
Name: shew_3182
Funciton: tetraheme cytochrome c
shew_3181-shew_3182 -207 4.3 TTTTGTGAAGCACAGCAAAGAT Shew_3181
Shewanella putrefaciens CN-32
Position: -216
Score: 4.21415
Sequence: TTTTGTGAAGCACTGCAAAGAT
Locus tag: Sputcn32_3387
Name: shew_3181
Funciton: twin-arginine translocation pathway signal precursor
Locus tag: Sputcn32_3388
Name: shew_3182
Funciton: tetraheme cytochrome c
shew_3181-shew_3182 -216 4.2 TTTTGTGAAGCACTGCAAAGAT Sputcn32_3387
Shewanella sp W3-18-1
Position: -216
Score: 4.21415
Sequence: TTTTGTGAAGCACTGCAAAGAT
Locus tag: Sputw3181_0556
Name: shew_3181
Funciton: twin-arginine translocation pathway signal precursor
Locus tag: Sputw3181_0555
Name: shew_3182
Funciton: tetraheme cytochrome c
shew_3181-shew_3182 -216 4.2 TTTTGTGAAGCACTGCAAAGAT Sputw3181_0556