Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing SO1597 gene

Properties
Regulog: Crp - Shewanellaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria
Built upon 2713 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella pealeana ATCC 700345
Position: -269
Score: 3.94269
Sequence: AAGCAAGATTTAGATCACACTT
Locus tag: Spea_2906
Name: SO1603
Funciton: putative transcriptional regulator, inferred for PFA pathway
Locus tag: Spea_2907
Name: SO1602
Funciton: omega-3 polyunsaturated fatty acid synthase subunit, PfaA
Locus tag: Spea_2908
Name: Sputcn32_1325
Funciton: omega-3 polyunsaturated fatty acid synthase PfaB
Locus tag: Spea_2909
Name: SO1599
Funciton: omega-3 polyunsaturated fatty acid synthase subunit, PfaC
Locus tag: Spea_2910
Name: SO1597
Funciton: enoyl-[acyl-carrier-protein] reductase [FMN] (EC 1.3.1.9), inferred for PFA pathway
SO1603-SO1602-Sputcn32_1325-SO1599-SO1597 -269 3.9 AAGCAAGATTTAGATCACACTT Spea_2906
Shewanella sediminis HAW-EB3
Position: -267
Score: 4.64751
Sequence: TTATTTGACCTGGATCACGCTT
Locus tag: Ssed_3201
Name: SO1603
Funciton: putative transcriptional regulator, inferred for PFA pathway
Locus tag: Ssed_3202
Name: SO1602
Funciton: omega-3 polyunsaturated fatty acid synthase subunit, PfaA
Locus tag: Ssed_3203
Name: Sputcn32_1325
Funciton: omega-3 polyunsaturated fatty acid synthase PfaB
Locus tag: Ssed_3204
Name: SO1599
Funciton: omega-3 polyunsaturated fatty acid synthase subunit, PfaC
Locus tag: Ssed_3205
Name: SO1597
Funciton: enoyl-[acyl-carrier-protein] reductase [FMN] (EC 1.3.1.9), inferred for PFA pathway
SO1603-SO1602-Sputcn32_1325-SO1599-SO1597 -267 4.6 TTATTTGACCTGGATCACGCTT Ssed_3201